CRISPR

CRISPR2-wars1

ID
ZDB-CRISPR-230222-7
Name
CRISPR2-wars1
Previous Names
None
Target
Sequence
5' - GGAGTGTCGGCGCTTCACCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-wars1
No data available
Phenotype
Phenotype resulting from CRISPR2-wars1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-wars1
Phenotype Fish Conditions Figures
Meckel's cartilage decreased length, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 4 with image from Lin et al., 2022
response to auditory stimulus disrupted, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 5 with image from Lin et al., 2022
skeletal muscle skeletal muscle myofibril dissociated from skeletal muscle muscle tendon junction, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 4 with image from Lin et al., 2022
head decreased size, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 3 with image from Lin et al., 2022
retina layer formation disrupted, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 3 with image from Lin et al., 2022
pericardium edematous, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 3 with image from Lin et al., 2022
skeletal muscle actin filament disorganized, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 4 with image from Lin et al., 2022
eye decreased size, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 3 with image from Lin et al., 2022
ventral mandibular arch shortened, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 3 with image from Lin et al., 2022
brain cell irregular density, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 3 with image from Lin et al., 2022
palatoquadrate cartilage angle ceratohyal cartilage, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 4 with image from Lin et al., 2022
brain morphology, abnormal NHGRI-1 + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 3 with image from Lin et al., 2022
hair cell posterior macula decreased amount, abnormal s356tTg + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 5 with image from Lin et al., 2022
otic sensory epithelium hair cell decreased amount, abnormal s356tTg + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 5 with image from Lin et al., 2022
otolith decreased size, abnormal s356tTg + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 5 with image from Lin et al., 2022
otic vesicle decreased size, abnormal s356tTg + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 5 with image from Lin et al., 2022
lateral crista decreased amount, abnormal s356tTg + CRISPR1-wars1 + CRISPR2-wars1 + CRISPR3-wars1 + CRISPR4-wars1 standard conditions Fig. 5 with image from Lin et al., 2022
Citations