CRISPR

CRISPR1-katnal2

ID
ZDB-CRISPR-230207-7
Name
CRISPR1-katnal2
Previous Names
None
Target
Sequence
5' - GTCTCCTATCATCAGGAACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3701 katnal2
Expression
Gene expression in Wild Types + CRISPR1-katnal2
No data available
Phenotype
Phenotype resulting from CRISPR1-katnal2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-katnal2
Phenotype Fish Conditions Figures
whole organism katnal2 expression decreased amount, abnormal katnal2zf3701/zf3701 standard conditions Fig. 1 with image from Zheng et al., 2022
neural plate tbxta expression spatial pattern, ameliorated katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
locomotory behavior decreased process quality, abnormal katnal2zf3701/zf3701 standard conditions Fig. 4 with imageFig. 5 with image from Zheng et al., 2022
social behavior decreased process quality, abnormal katnal2zf3701/zf3701 standard conditions Fig. 6 with image from Zheng et al., 2022
midbrain decreased distance forebrain, abnormal katnal2zf3701/zf3701 standard conditions Fig. 3 with image from Zheng et al., 2022
axial mesoderm tbxta expression spatial pattern, ameliorated katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
epiboly delayed, abnormal katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
circadian sleep/wake cycle decreased process quality, abnormal katnal2zf3701/zf3701 standard conditions Fig. 4 with image from Zheng et al., 2022
midbrain decreased area, abnormal katnal2zf3701/zf3701 standard conditions Fig. 3 with image from Zheng et al., 2022
eye decreased distance eye, abnormal katnal2zf3701/zf3701 standard conditions Fig. 3 with image from Zheng et al., 2022
blastoderm decreased thickness, abnormal katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
neural plate dlx3b expression spatial pattern, ameliorated katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
forebrain decreased area, abnormal katnal2zf3701/zf3701 standard conditions Fig. 3 with image from Zheng et al., 2022
hatching behavior decreased process quality, abnormal katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
behavioral fear response increased frequency, abnormal katnal2zf3701/zf3701 standard conditions Fig. 5 with image from Zheng et al., 2022
swimming behavior decreased linear velocity, abnormal katnal2zf3701/zf3701 standard conditions Fig. 5 with image from Zheng et al., 2022
whole organism shortened, abnormal katnal2zf3701/zf3701 standard conditions Fig. 3 with image from Zheng et al., 2022
optic tectum decreased distance optic tectum, abnormal katnal2zf3701/zf3701 standard conditions Fig. 3 with image from Zheng et al., 2022
axial mesoderm dlx3b expression spatial pattern, ameliorated katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
convergent extension involved in gastrulation decreased process quality, abnormal katnal2zf3701/zf3701 standard conditions Fig. 2 with image from Zheng et al., 2022
Citations