CRISPR

CRISPR2-hspb7

ID
ZDB-CRISPR-230117-12
Name
CRISPR2-hspb7
Previous Names
None
Target
Sequence
5' - CATGTGTCCGAAGGATGCTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-hspb7
No data available
Phenotype
Phenotype resulting from CRISPR2-hspb7
Phenotype Fish Figures
cranial cartilage malformed, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
fin malformed, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
heart malformed, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
mandibular arch skeleton malformed, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
neural tube malformed, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
pericardium edematous, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
swim bladder uninflated, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
whole organism malformed, abnormal WIK + CRISPR2-hspb7 FIGURE 3 with image from Winter et al., 2022
Phenotype of all Fish created by or utilizing CRISPR2-hspb7
Phenotype Fish Conditions Figures
heart malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
swim bladder absent, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
pericardium edematous, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
fin malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
liver absent, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
somite malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
heart morphology, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
caudal fin malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
neural tube malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
mandibular arch skeleton malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
swim bladder uninflated, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
ball increased amount, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
notochord malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
cranial cartilage malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
heart decreased size, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
atrium malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
cardiac ventricle malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
whole organism malformed, abnormal WIK + CRISPR1-hspb7 + CRISPR2-hspb7 + CRISPR3-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
neural tube malformed, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
mandibular arch skeleton malformed, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
whole organism malformed, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
pericardium edematous, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
fin malformed, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
swim bladder uninflated, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
heart malformed, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
cranial cartilage malformed, abnormal WIK + CRISPR2-hspb7 standard conditions FIGURE 3 with image from Winter et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.