CRISPR

CRISPR1-hnrnpul1l

ID

ZDB-CRISPR-221115-5

Name

CRISPR1-hnrnpul1l

Previous Names

None

Target

hnrnpul1l (1)

Sequence

5' - GCGAACTGATGAGGAAGGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ca52	hnrnpul1l

Expression

Gene expression in Wild Types + CRISPR1-hnrnpul1l

No data available

Phenotype

Phenotype resulting from CRISPR1-hnrnpul1l

No data available

Phenotype of all Fish created by or utilizing CRISPR1-hnrnpul1l

Phenotype	Fish	Conditions	Figures
mandibular arch skeleton open, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/+	standard conditions	Fig. 6. from Blackwell et al., 2022
pectoral fin decreased area, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 3. from Blackwell et al., 2022
whole organism hnrnpul1 expression decreased distribution, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 1. from Blackwell et al., 2022
vertebral column bent, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 5. from Blackwell et al., 2022
whole organism hnrnpul1l expression decreased amount, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 2. from Blackwell et al., 2022
sternohyoid tendon scxa expression spatial pattern, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 6. from Blackwell et al., 2022
whole organism alternative mRNA splicing, via spliceosome increased process quality, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 2. from Blackwell et al., 2022
pectoral fin distal radial decreased amount, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 4. from Blackwell et al., 2022
pectoral fin cell ab4-h3 labeling decreased distribution, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 3. from Blackwell et al., 2022
whole organism decreased length, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 1. from Blackwell et al., 2022
vertebral column kinked, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 5. from Blackwell et al., 2022
trunk muscle cell disorganized, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 5. from Blackwell et al., 2022
vertebral column asymmetrically curved, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 5. from Blackwell et al., 2022
pectoral fin cell population proliferation decreased process quality, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 3. from Blackwell et al., 2022
pectoral fin decreased length, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 3. from Blackwell et al., 2022
pectoral fin proximal radial decreased amount, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 4. from Blackwell et al., 2022
whole organism hnrnpul1 expression decreased amount, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 2. from Blackwell et al., 2022
pectoral fin muscle ab-mf20 labeling spatial pattern, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 4. from Blackwell et al., 2022
pectoral fin cartilage decreased amount, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 4. from Blackwell et al., 2022
mandibular arch skeleton open, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 6. from Blackwell et al., 2022
trunk skeletal muscle ab-mf20 labeling spatial pattern, abnormal	hnrnpul1^ca54/ca54; hnrnpul1l^ca52/ca52	standard conditions	Fig. 5. from Blackwell et al., 2022

Citations