CRISPR

CRISPR1-atf3

ID
ZDB-CRISPR-220927-1
Name
CRISPR1-atf3
Previous Names
None
Target
Sequence
5' - GGTCAGGGTGCTCATGCCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3482 atf3
zf3483 atf3
zf3484 atf3
zf3485 atf3
zf3486 atf3
Expression
Gene expression in Wild Types + CRISPR1-atf3
No data available
Phenotype
Phenotype resulting from CRISPR1-atf3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-atf3
Phenotype Fish Conditions Figures
whole organism atf3 expression decreased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 2 from Yin et al., 2020
whole organism nox5 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
anterior lateral plate mesoderm hand2 expression increased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
atrium dilated, abnormal atf3zf3482/zf3482 standard conditions Fig. 2 from Yin et al., 2020
whole organism gpx3 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
hematopoietic multipotent progenitor cell tal1 expression increased distribution, abnormal atf3zf3482/zf3482 chemical treatment: glucose Fig. 6 from Yin et al., 2020
presumptive atrium primitive heart tube myh6 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 3 from Yin et al., 2020
whole organism eif2ak3 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
whole organism gpx7 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
anterior lateral plate mesoderm tal1 expression increased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 3,  Fig. 5 from Yin et al., 2020
presumptive cardiac ventricle primitive heart tube myh7 expression decreased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 3 from Yin et al., 2020
anterior lateral plate mesoderm nkx2.5 expression decreased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 5 from Yin et al., 2020
whole organism ern1 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
heart primordium slc2a1a expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
neutrophil mpx expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 3 from Yin et al., 2020
hematopoietic multipotent progenitor cell tal1 expression increased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
rostral blood island cebpg expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 5 from Yin et al., 2020
anterior lateral plate mesoderm posterior side nkx2.5 expression increased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 3 from Yin et al., 2020
anterior lateral plate mesoderm hand2 expression increased distribution, abnormal atf3zf3482/zf3482 chemical treatment: glucose Fig. 6 from Yin et al., 2020
anterior lateral plate mesoderm cebpg expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 5 from Yin et al., 2020
anterior lateral plate mesoderm posterior side gata4 expression increased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 3 from Yin et al., 2020
whole organism pck1 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
erythroid progenitor cell spi1b expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 3 from Yin et al., 2020
whole organism slc2a1b expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
whole organism ddit3 expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
heart primordium nkx2.5 expression increased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 4 from Yin et al., 2020
anterior lateral plate mesoderm posterior side hand2 expression increased distribution, abnormal atf3zf3482/zf3482 standard conditions Fig. 3 from Yin et al., 2020
whole organism slc2a1a expression increased amount, abnormal atf3zf3482/zf3482 standard conditions Fig. 6 from Yin et al., 2020
cardiac ventricle atrophied, abnormal atf3zf3482/zf3482 standard conditions Fig. 2 from Yin et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 2 from Yin et al., 2020
heart contraction increased magnitude, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 2 from Yin et al., 2020
heart contraction decreased frequency, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 2 from Yin et al., 2020
heart blood circulation disrupted, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 2 from Yin et al., 2020
cardiac ventricle endocardium decreased amount, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 2 from Yin et al., 2020
atrium endocardium increased amount, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 2 from Yin et al., 2020
atrium cardiac muscle cell increased amount, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 2 from Yin et al., 2020
common myeloid progenitor increased amount, abnormal atf3zf3482/zf3482; f2Tg standard conditions Fig. 3 from Yin et al., 2020
atrium dilated, exacerbated atf3zf3482/zf3482; fb7Tg chemical treatment: glucose Fig. 6 from Yin et al., 2020
atrium dilated, abnormal atf3zf3482/zf3482; fb7Tg standard conditions Fig. 4,  Fig. 5,  Fig. 6 from Yin et al., 2020
anterior lateral plate mesoderm nkx2.5 expression amount, ameliorated atf3zf3482/zf3482 + MO1-cebpg standard conditions Fig. 5 from Yin et al., 2020
heart primordium nkx2.5 expression amount, ameliorated atf3zf3482/zf3482 + MO4-tal1 standard conditions Fig. 4 from Yin et al., 2020
atrium size, ameliorated atf3zf3482/zf3482 + MO5-slc2a1a chemical treatment: glucose Fig. 6 from Yin et al., 2020
anterior lateral plate mesoderm hand2 expression amount, ameliorated atf3zf3482/zf3482 + MO5-slc2a1a standard conditions Fig. 6 from Yin et al., 2020
hematopoietic multipotent progenitor cell tal1 expression position, ameliorated atf3zf3482/zf3482 + MO5-slc2a1a standard conditions Fig. 6 from Yin et al., 2020
atrium size, ameliorated atf3zf3482/zf3482; fb7Tg + MO1-cebpg standard conditions Fig. 5 from Yin et al., 2020
anterior lateral plate mesoderm tal1 expression amount, ameliorated atf3zf3482/zf3482; fb7Tg + MO1-cebpg standard conditions Fig. 5 from Yin et al., 2020
atrium size, ameliorated atf3zf3482/zf3482; fb7Tg + MO4-tal1 standard conditions Fig. 4 from Yin et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.