CRISPR

CRISPR3-cep290

ID

ZDB-CRISPR-220916-3

Name

CRISPR3-cep290

Previous Names

None

Target

cep290 (1)

Sequence

5' - GGAAGGCCTTAGGGATCTGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fb208	cep290

Expression

Gene expression in Wild Types + CRISPR3-cep290

No data available

Phenotype

Phenotype resulting from CRISPR3-cep290

No data available

Phenotype of all Fish created by or utilizing CRISPR3-cep290

Phenotype	Fish	Conditions	Figures
eye unc119a2 expression increased amount, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 5. from Cardenas-Rodriguez et al., 2021
whole organism cep290 expression absent, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 1. from Cardenas-Rodriguez et al., 2021
kidney unc119a2 expression increased amount, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 6. from Cardenas-Rodriguez et al., 2021
axis curved, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 4. from Cardenas-Rodriguez et al., 2021
retina layer formation disrupted, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 2. , Fig. 3. from Cardenas-Rodriguez et al., 2021
post-vent region curved, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 4. from Cardenas-Rodriguez et al., 2021
retinal outer plexiform layer cep290 expression absent, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 2. from Cardenas-Rodriguez et al., 2021
retinal inner plexiform layer cep290 expression absent, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 2. from Cardenas-Rodriguez et al., 2021
whole organism arl13b expression increased amount, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 5. from Cardenas-Rodriguez et al., 2021
eye arl3b expression increased amount, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 5. from Cardenas-Rodriguez et al., 2021
whole organism unc119a2 expression increased amount, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 5. from Cardenas-Rodriguez et al., 2021
eye arl13b expression increased amount, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 5. from Cardenas-Rodriguez et al., 2021
axis kinked, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 4. from Cardenas-Rodriguez et al., 2021
peripheral olfactory organ cilium cep290 expression absent, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 2. from Cardenas-Rodriguez et al., 2021
Kupffer's vesicle ciliary base cep290 expression absent, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 2. from Cardenas-Rodriguez et al., 2021
whole organism arl3b expression increased amount, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 5. from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 1. from Cardenas-Rodriguez et al., 2021
pronephros cilium cep290 expression absent, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 2. from Cardenas-Rodriguez et al., 2021
photoreceptor outer segment layer disorganized, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 3. from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 1. from Cardenas-Rodriguez et al., 2021
photoreceptor outer segment layer photoreceptor connecting cilium accumulation photoreceptor outer segment layer vesicle, abnormal	cep290^fb208/fb208 (AB/TU)	standard conditions	Fig. 3. from Cardenas-Rodriguez et al., 2021

Citations