CRISPR

CRISPR1-focad

ID
ZDB-CRISPR-220913-51
Name
CRISPR1-focad
Previous Names
None
Target
Sequence
5' - CTCGGCCTGCTGTAACGCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 7
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
imb6 focad
imb7 focad
Expression
Gene expression in Wild Types + CRISPR1-focad
No data available
Phenotype
Phenotype resulting from CRISPR1-focad
No data available
Phenotype of all Fish created by or utilizing CRISPR1-focad
Phenotype Fish Conditions Figures
whole organism semi-viable, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
whole organism decreased weight, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver mfap4.12 expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver sh3bp5b expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver mhc1uba expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver cyp3c2 expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver saa expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
hepatocyte vacuolated, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver nlrp3l2 expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver hp expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism brain focad expression absent, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
liver has extra parts of type liver collagen trimer, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver rnasel2 expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
hepatocyte apoptotic process increased occurrence, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
hepatocyte apoptotic, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver focad expression decreased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
whole organism decreased length, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
male organism liver lgals8b expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
male organism liver coch expression increased amount, abnormal focadimb6/imb6 (AB) standard conditions Fig. 4 from Moreno Traspas et al., 2022
hepatocyte swollen, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
whole organism decreased fertility, abnormal focadimb6/imb6 (AB) standard conditions Fig. 3 from Moreno Traspas et al., 2022
Citations