CRISPR

CRISPR1-apobb.1

ID

ZDB-CRISPR-220718-3

Name

CRISPR1-apobb.1

Previous Names

None

Target

apobb.1 (1)

Sequence

5' - GTCAAAGACCACACTAGTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wz25	apobb.1

Expression

Gene expression in Wild Types + CRISPR1-apobb.1

No data available

Phenotype

Phenotype resulting from CRISPR1-apobb.1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-apobb.1

Phenotype	Fish	Conditions	Figures
liver hepatocyte has extra parts of type hepatocyte lipid droplet, abnormal	apobb.1^wz25/wz25	standard conditions	Figure 2 from Templehof et al., 2021
whole organism apobb.1 expression decreased amount, abnormal	apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
yolk opaque, abnormal	apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
blood lipid decreased amount, abnormal	apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
liver fatty, abnormal	apobb.1^wz25/wz25	standard conditions	Figure 2 from Templehof et al., 2021
whole organism triglyceride decreased amount, abnormal	apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal	apobb.1^wz25/wz25; y1Tg	standard conditions	Figure 4 from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal	apobb.1^wz25/wz25; y1Tg	standard conditions	Figure 4 from Templehof et al., 2021
whole organism apoba expression decreased amount, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
yolk opaque, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
trunk curved dorsal, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
whole organism apobb.1 expression decreased amount, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
heart edematous, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
yolk increased volume, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
blood lipid decreased amount, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
whole organism triglyceride decreased amount, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
whole organism cholesterol decreased amount, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
yolk edematous, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25	standard conditions	Figure 1 from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25; y1Tg	standard conditions	Figure 4 from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal	apoba^wz26/wz26; apobb.1^wz25/wz25; y1Tg	standard conditions	Figure 4 from Templehof et al., 2021

Citations