CRISPR

CRISPR1-stim2a

ID

ZDB-CRISPR-220329-1

Name

CRISPR1-stim2a

Previous Names

None

Target

stim2a (1)

Sequence

5' - GGGTGCGCGGTGCACTGAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first "G" was added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
waw303	stim2a

Expression

Gene expression in Wild Types + CRISPR1-stim2a

No data available

Phenotype

Phenotype resulting from CRISPR1-stim2a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-stim2a

Phenotype	Fish	Conditions	Figures
swimming increased occurrence, abnormal	stim2a^{waw303/waw303}	light intensity	Fig. 5 from Gupta et al., 2020
swimming increased occurrence, abnormal	stim2a^{waw303/waw303}	chemical treatment by environment: pentetrazol	Fig. 8 from Gupta et al., 2020
phototaxis decreased occurrence, abnormal	stim2a^{waw303/waw303}	light intensity	Fig. 5 from Gupta et al., 2020
whole organism habituation delayed, abnormal	stim2a^{waw303/waw303}	standard conditions	Fig. 4 from Gupta et al., 2020
swimming increased occurrence, abnormal	stim2a^{waw303/waw303}	standard conditions	Fig. 4 from Gupta et al., 2020
swimming increased occurrence, abnormal	stim2a^{waw303/waw303}	chemical treatment by environment: glutamic acid	Fig. 8 from Gupta et al., 2020
periventricular grey zone calcium ion transport increased frequency, abnormal	stim2a^{waw303/waw303}; a4598Tg	standard conditions	Fig. 7 from Gupta et al., 2020
periventricular grey zone calcium ion decreased amount, abnormal	stim2a^{waw303/waw303}; a4598Tg	standard conditions	Fig. 7 from Gupta et al., 2020
periventricular grey zone calcium ion transport increased frequency, abnormal	stim2a^{waw303/waw303}; a4598Tg	chemical treatment by environment: glutamic acid	Fig. 7 from Gupta et al., 2020
retinal inner plexiform layer decreased width, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 6 from Baranykova et al., 2024
retinal photoreceptor layer eye photoreceptor cell area density, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 5 from Baranykova et al., 2024
eye photoreceptor cell mitochondrial crista decreased area, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 7 from Baranykova et al., 2024
retinal ganglion cell layer retinal ganglion cell decreased amount, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 6 from Baranykova et al., 2024
whole organism decreased weight, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 3 from Baranykova et al., 2024
retinal ganglion cell layer decreased width, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 6 from Baranykova et al., 2024
retinal inner nuclear layer amacrine cell area density, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 5 from Baranykova et al., 2024
retinal inner plexiform layer dendrite decreased amount, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 6 from Baranykova et al., 2024
retinal inner nuclear layer amacrine cell decreased amount, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 5 from Baranykova et al., 2024
retinal ganglion cell layer microglial cell increased amount, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 6 from Baranykova et al., 2024
retinal photoreceptor layer eye photoreceptor cell decreased amount, abnormal	stim2a^{waw303/waw303}; stim2b^{waw301/waw301} (AB)	standard conditions	Fig. 5 from Baranykova et al., 2024

Citations