CRISPR

CRISPR2-pi4kb

ID
ZDB-CRISPR-211213-2
Name
CRISPR2-pi4kb
Previous Names
None
Target
Sequence
5' - GGTTGCTGGCGGTTCTCTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3540 pi4kb
zf3541 pi4kb
zko2065A pi4kb
zko2065B pi4kb
Expression
Gene expression in Wild Types + CRISPR2-pi4kb
No data available
Phenotype
Phenotype resulting from CRISPR2-pi4kb
No data available
Phenotype of all Fish created by or utilizing CRISPR2-pi4kb
Phenotype Fish Conditions Figures
auditory receptor cell morphology, abnormal pi4kbzf3540/zf3540 standard conditions Fig. 3 from Feng et al., 2020
yolk syncytial layer edematous, abnormal pi4kbzf3540/zf3540 standard conditions Fig. S2 from Feng et al., 2020
eye hemorrhagic, abnormal pi4kbzf3540/zf3540 standard conditions Fig. S2 from Feng et al., 2020
saccule cilium decreased amount, abnormal pi4kbzf3540/zf3540 standard conditions Fig. 3 from Feng et al., 2020
sensory perception of sound disrupted, abnormal pi4kbzf3540/zf3540 standard conditions Fig. 4 from Feng et al., 2020
pronephros cilium absence of anatomical entity, abnormal pi4kbzf3540/zf3540 standard conditions Fig. 4 with image from Lu et al., 2021
whole organism decreased life span, abnormal pi4kbzf3540/zf3540 standard conditions Fig. S2 from Feng et al., 2020
eye edematous, abnormal pi4kbzf3540/zf3540 standard conditions Fig. S2 from Feng et al., 2020
auditory receptor cell mitochondrion swollen, abnormal pi4kbzf3540/zf3540 standard conditions Fig. 3 from Feng et al., 2020
pronephric tubule increased diameter, abnormal pi4kbzf3540/zf3540 standard conditions Fig. 4 with image from Lu et al., 2021
eye decreased size, abnormal pi4kbzf3540/zf3540 standard conditions Fig. S2 from Feng et al., 2020
whole organism dead, abnormal pi4kbzf3540/zf3540 standard conditions Fig. S2 from Feng et al., 2020
pericardium edematous, abnormal pi4kbzf3540/zf3540 standard conditions Fig. S2 from Feng et al., 2020
yolk syncytial layer edematous, abnormal pi4kbzf3541/zf3541 standard conditions Fig. S2 from Feng et al., 2020
eye hemorrhagic, abnormal pi4kbzf3541/zf3541 standard conditions Fig. S2 from Feng et al., 2020
pronephros cilium absence of anatomical entity, abnormal pi4kbzf3541/zf3541 standard conditions Fig. 4 with image from Lu et al., 2021
whole organism decreased life span, abnormal pi4kbzf3541/zf3541 standard conditions Fig. S2 from Feng et al., 2020
eye edematous, abnormal pi4kbzf3541/zf3541 standard conditions Fig. S2 from Feng et al., 2020
whole organism dead, abnormal pi4kbzf3541/zf3541 standard conditions Fig. S2 from Feng et al., 2020
pronephric tubule increased diameter, abnormal pi4kbzf3541/zf3541 standard conditions Fig. 4 with image from Lu et al., 2021
eye decreased size, abnormal pi4kbzf3541/zf3541 standard conditions Fig. S2 from Feng et al., 2020
pericardium edematous, abnormal pi4kbzf3541/zf3541 standard conditions Fig. S2 from Feng et al., 2020
pillar of the semicircular canal morphology, abnormal pi4kbzf3540/zf3540; s356tTg standard conditions Fig. 3 from Feng et al., 2020
otic vesicle decreased size, abnormal pi4kbzf3540/zf3540; s356tTg standard conditions Fig. 3 from Feng et al., 2020
semicircular canal morphology, abnormal pi4kbzf3540/zf3540; s356tTg standard conditions Fig. 3 from Feng et al., 2020
anterior crista cilium decreased amount, abnormal pi4kbzf3540/zf3540; s356tTg standard conditions Fig. 3 from Feng et al., 2020
posterior crista cilium decreased amount, abnormal pi4kbzf3540/zf3540; s356tTg standard conditions Fig. 3 from Feng et al., 2020
neuromast hair cell cilium decreased amount, abnormal pi4kbzf3540/zf3540; s356tTg standard conditions Fig. 3 from Feng et al., 2020
lateral crista cilium decreased amount, abnormal pi4kbzf3540/zf3540; s356tTg standard conditions Fig. 3 from Feng et al., 2020
pillar of the semicircular canal morphology, abnormal pi4kbzf3541/zf3541; s356tTg standard conditions Fig. 3 from Feng et al., 2020
otic vesicle decreased size, abnormal pi4kbzf3541/zf3541; s356tTg standard conditions Fig. 3 from Feng et al., 2020
semicircular canal morphology, abnormal pi4kbzf3541/zf3541; s356tTg standard conditions Fig. 3 from Feng et al., 2020
anterior crista cilium decreased amount, abnormal pi4kbzf3541/zf3541; s356tTg standard conditions Fig. 3 from Feng et al., 2020
neuromast hair cell cilium decreased amount, abnormal pi4kbzf3541/zf3541; s356tTg standard conditions Fig. 3 from Feng et al., 2020
posterior crista cilium decreased amount, abnormal pi4kbzf3541/zf3541; s356tTg standard conditions Fig. 3 from Feng et al., 2020
lateral crista cilium decreased amount, abnormal pi4kbzf3541/zf3541; s356tTg standard conditions Fig. 3 from Feng et al., 2020
Citations