CRISPR

CRISPR1-cdnf

ID

ZDB-CRISPR-211104-1

Name

CRISPR1-cdnf

Previous Names

None

Target

cdnf (1)

Sequence

5' - GGCCCTCCTCCACCAGCTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 4

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hki3	cdnf

Expression

Gene expression in Wild Types + CRISPR1-cdnf

No data available

Phenotype

Phenotype resulting from CRISPR1-cdnf

No data available

Phenotype of all Fish created by or utilizing CRISPR1-cdnf

Phenotype	Fish	Conditions	Figures
hypothalamus cell population proliferation decreased frequency, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 5 from Chen et al., 2020
brain histamine decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Table 2 from Chen et al., 2020
brain cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 3, Fig. 13 from Chen et al., 2020
ventral thalamus slc32a1 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 7 from Chen et al., 2020
hypothalamus elavl3 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 5 from Chen et al., 2020
optic tectum cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 2 from Chen et al., 2020
hypothalamus slc32a1 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 7 from Chen et al., 2020
brain gad2 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 13 from Chen et al., 2020
hypothalamus dopaminergic neuron th expression increased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 4 from Chen et al., 2020
regulation of transmission of nerve impulse disrupted, abnormal	cdnf^hki3/hki3	chemical treatment by environment: pentetrazol	Fig. 12 from Chen et al., 2020
hypothalamus hdc expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 5 from Chen et al., 2020
rostral parvocellular preoptic nucleus cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 2 from Chen et al., 2020
brain slc32a1 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 13 from Chen et al., 2020
hypothalamus cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 2 from Chen et al., 2020
brain th2 expression increased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 3 from Chen et al., 2020
brain gfap expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 13 from Chen et al., 2020
brain dihydroxyphenylacetic acid decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Table 2 from Chen et al., 2020
whole organism slc32a1 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 7 from Chen et al., 2020
swimming increased linear velocity, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 11 from Chen et al., 2020
swimming decreased duration, abnormal	cdnf^hki3/hki3	constant dark	Fig. 8 from Chen et al., 2020
involuntary skeletal muscle contraction increased occurrence, abnormal	cdnf^hki3/hki3	chemical treatment by environment: pentetrazol	Fig. 12 from Chen et al., 2020
caudal hypothalamic zone GABAergic neuron decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 6 from Chen et al., 2020
raphe nucleus cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 2 from Chen et al., 2020
ventral thalamus dopaminergic neuron th expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 4 from Chen et al., 2020
caudal tuberculum cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 2 from Chen et al., 2020
swimming increased duration, abnormal	cdnf^hki3/hki3	constant light	Fig. 8 from Chen et al., 2020
brain serotonin increased amount, abnormal	cdnf^hki3/hki3	standard conditions	Table 2 from Chen et al., 2020
raphe nucleus radial glial cell gfap expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 13 from Chen et al., 2020
brain 5-Hydroxytryptophol decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Table 2 from Chen et al., 2020
whole organism cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 3 from Chen et al., 2020
caudal tuberculum GABAergic neuron decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 6 from Chen et al., 2020
brain cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	chemical treatment by environment: pentetrazol	Fig. 13 from Chen et al., 2020
brain sox2 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 5 from Chen et al., 2020
caudal tuberculum slc32a1 expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 7 from Chen et al., 2020
brain hdc expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 3 from Chen et al., 2020
brain homovanillic acid decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Table 2 from Chen et al., 2020
brain gfap expression amount, ameliorated	cdnf^hki3/hki3	chemical treatment by environment: pentetrazol	Fig. 13 from Chen et al., 2020
hypothalamus ab1-histamine labeling decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 5 from Chen et al., 2020
tegmentum cdnf expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 2 from Chen et al., 2020
brain slc17a6b expression decreased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 13 from Chen et al., 2020
whole organism th2 expression increased amount, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 3 from Chen et al., 2020
social behavior disrupted, abnormal	cdnf^hki3/hki3	standard conditions	Fig. 9 from Chen et al., 2020

Citations

Include unpublished citations

Chen, Y.C., Baronio, D., Semenova, S., Abdurakhmanova, S., Panula, P. (2020) Cerebral Dopamine Neurotrophic Factor regulates multiple neuronal subtypes and behavior. The Journal of neuroscience : the official journal of the Society for Neuroscience. 40(32):6146-6164

1 - 1 of 1

Show