CRISPR

CRISPR3-b3galt6

ID
ZDB-CRISPR-210820-1
Name
CRISPR3-b3galt6
Previous Names
None
Target
Sequence
5' - GGGAGCTCTTTAGGACGAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 11
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cmg20 b3galt6
cmg22 b3galt6
Expression
Gene expression in Wild Types + CRISPR3-b3galt6
No data available
Phenotype
Phenotype resulting from CRISPR3-b3galt6
No data available
Phenotype of all Fish created by or utilizing CRISPR3-b3galt6
Phenotype Fish Conditions Figures
head cartilage development delayed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with image from Delbaere et al., 2020
preural vertebra fused with preural vertebra, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
fin decreased size, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 4 with image from Delbaere et al., 2020
muscle heparan sulfate decreased amount, abnormal b3galt6cmg20/cmg20 standard conditions Table 1 from Delbaere et al., 2020
integument chondroitin sulfate decreased amount, abnormal b3galt6cmg20/cmg20 standard conditions Table 1 from Delbaere et al., 2020
olfactory region decreased size, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
muscle dermatan sulfate decreased amount, abnormal b3galt6cmg20/cmg20 standard conditions Table 1 from Delbaere et al., 2020
swimming decreased efficacy, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 8 with image from Delbaere et al., 2020
integument collagen network decreased mass density, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 7 with image from Delbaere et al., 2020
bone tissue chondroitin sulfate decreased amount, abnormal b3galt6cmg20/cmg20 standard conditions Table 1 from Delbaere et al., 2020
centrum bone tissue mislocalised, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
whole organism decreased weight, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 4 with image from Delbaere et al., 2020
pectoral fin radial fused with pectoral fin radial, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
head bone mineralization delayed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with image from Delbaere et al., 2020
pectoral fin cartilage development delayed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with image from Delbaere et al., 2020
pigment cell mislocalised, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 4 with image from Delbaere et al., 2020
centrum decreased volume, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 6 with image from Delbaere et al., 2020
muscle A band increased size, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 8 with image from Delbaere et al., 2020
whole organism b3galt6 expression decreased amount, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 1 with image from Delbaere et al., 2020
integument heparan sulfate decreased amount, abnormal b3galt6cmg20/cmg20 standard conditions Table 1 from Delbaere et al., 2020
integument dermatan sulfate decreased amount, abnormal b3galt6cmg20/cmg20 standard conditions Table 1 from Delbaere et al., 2020
pectoral fin dorsal orientation, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 4 with image from Delbaere et al., 2020
pigmentation disrupted, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 4 with image from Delbaere et al., 2020
integument epidermis increased thickness, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 7 with image from Delbaere et al., 2020
centrum collagen-containing extracellular matrix disorganized, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 7 with image from Delbaere et al., 2020
neurocranium deformed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
head decreased length, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with imageFIGURE 4 with image from Delbaere et al., 2020
caudal fin cartilage development delayed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with image from Delbaere et al., 2020
muscle sarcomere increased size, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 8 with image from Delbaere et al., 2020
pectoral fin radial malformed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
cranium morphology, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with imageFIGURE 4 with imageFIGURE 5 with image from Delbaere et al., 2020
pectoral girdle bone mineralization delayed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with image from Delbaere et al., 2020
pectoral fin radial decreased size, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
scale anatomical margin mineralized, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 5 with image from Delbaere et al., 2020
muscle I band increased size, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 8 with image from Delbaere et al., 2020
opercular flap posterior margin malformed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with imageFIGURE 4 with image from Delbaere et al., 2020
swimming decreased linear velocity, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 8 with image from Delbaere et al., 2020
caudal fin bone mineralization delayed, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 3 with image from Delbaere et al., 2020
fin distal margin structurally discontinuous, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 4 with image from Delbaere et al., 2020
whole organism decreased length, abnormal b3galt6cmg20/cmg20 standard conditions FIGURE 4 with image from Delbaere et al., 2020
Citations