CRISPR

CRISPR1-mchr1a

ID
ZDB-CRISPR-210817-1
Name
CRISPR1-mchr1a
Previous Names
None
Target
Sequence
5' - GGTGGACAGTAGCCACATAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-mchr1a
No data available
Phenotype
Phenotype resulting from CRISPR1-mchr1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mchr1a
No data available
Citations