CRISPR

CRISPR1-oxr1a

ID
ZDB-CRISPR-210428-1
Name
CRISPR1-oxr1a
Previous Names
None
Target
Sequence
5' - GGTTCTGGAAAAAGGCTGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cq205 oxr1a
Expression
Gene expression in Wild Types + CRISPR1-oxr1a
No data available
Phenotype
Phenotype resulting from CRISPR1-oxr1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-oxr1a
Phenotype Fish Conditions Figures
liver prdx1 expression increased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
olfactory bulb apoptotic process increased process quality, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 5 from Xu et al., 2020
whole organism decreased weight, abnormal oxr1acq205/cq205 (AB) standard conditions Fig. 4 from Xu et al., 2020
gill gstp1.1 expression increased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
liver gstp1.2 expression increased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
whole organism gpx1b expression decreased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 6 from Xu et al., 2020
liver gstp1.1 expression increased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
whole organism lipid decreased amount, abnormal oxr1acq205/cq205 (AB) standard conditions Fig. 4 from Xu et al., 2020
female organism decreased fertility, abnormal oxr1acq205/cq205 (AB) standard conditions Fig. 5 from Xu et al., 2020
whole organism decreased length, abnormal oxr1acq205/cq205 (AB) standard conditions Fig. 4 from Xu et al., 2020
liver gstp1.2 expression increased distribution, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
gill gstp1.2 expression increased distribution, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
whole organism sod3a expression decreased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 6 from Xu et al., 2020
whole organism decreased life span, abnormal oxr1acq205/cq205 (AB) standard conditions Fig. 4 from Xu et al., 2020
liver gstp1.1 expression increased distribution, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
female organism oocyte maturation disrupted, abnormal oxr1acq205/cq205 (AB) standard conditions Fig. 5 from Xu et al., 2020
gill prdx1 expression increased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
liver prdx1 expression increased distribution, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
gill gstp1.1 expression increased distribution, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
whole organism gpx7 expression decreased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 6 from Xu et al., 2020
whole organism dead, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 5 from Xu et al., 2020
whole organism gpx4a expression decreased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 6 from Xu et al., 2020
gill prdx1 expression increased distribution, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
whole organism oxr1a expression absent, abnormal oxr1acq205/cq205 (AB) standard conditions Fig. 3 from Xu et al., 2020
gill gstp1.2 expression increased amount, abnormal oxr1acq205/cq205 (AB) chemical treatment by environment: hydrogen peroxide Fig. 7 from Xu et al., 2020
whole organism oxr1a expression decreased amount, abnormal oxr1acq205/+ (AB) standard conditions Fig. 3 from Xu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.