CRISPR

CRISPR1-lss

ID
ZDB-CRISPR-210319-7
Name
CRISPR1-lss
Previous Names
None
Target
Sequence
5' - GGACAGACCGCAGAGCATGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nu60 lss
Expression
Gene expression in Wild Types + CRISPR1-lss
No data available
Phenotype
Phenotype resulting from CRISPR1-lss
No data available
Phenotype of all Fish created by or utilizing CRISPR1-lss
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal lssnu60/nu60 standard conditions Fig. 3. with image from Anderson et al., 2020
whole organism dead, abnormal lssnu60/nu60 standard conditions Fig. 3. with image from Anderson et al., 2020
whole organism cholesterol decreased amount, abnormal lssnu60/nu60 standard conditions text only from Anderson et al., 2020
whole organism decreased life span, abnormal lssnu60/+; msmo1nu81/nu81 standard conditions Fig. 3. with image from Anderson et al., 2020
whole organism dead, abnormal lssnu60/+; msmo1nu81/nu81 standard conditions Fig. 3. with image from Anderson et al., 2020
whole organism embryo development delayed, abnormal lssnu60/nu60; msmo1nu81/nu81 standard conditions text only from Anderson et al., 2020
pterotic chondrocyte differentiation decreased process quality, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 5. with image from Anderson et al., 2020
endochondral bone ossification increased process quality, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 4. with image from Anderson et al., 2020
hypural condensed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 4. with image from Anderson et al., 2020
ceratohyal bone condensed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 4. with image from Anderson et al., 2020
pterotic hypertrophic chondrocyte msmo1 expression increased distribution, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 5. with image from Anderson et al., 2020
hyomandibula condensed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 4. with image from Anderson et al., 2020
pterotic columnar chondrocyte msmo1 expression increased distribution, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 5. with image from Anderson et al., 2020
postcranial axial skeleton ossification increased process quality, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 3. with image from Anderson et al., 2020
cranium ossification increased process quality, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 3. with image from Anderson et al., 2020
whole organism decreased length, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 3. with image from Anderson et al., 2020
pterotic chondrocyte col2a1a expression increased distribution, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 5. with image from Anderson et al., 2020
postcranial axial skeleton malformed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 3. with image from Anderson et al., 2020
hypural deformed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 4. with image from Anderson et al., 2020
hyomandibula deformed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 4. with image from Anderson et al., 2020
cranium malformed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 3. with image from Anderson et al., 2020
ceratohyal bone deformed, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 4. with image from Anderson et al., 2020
head decreased size, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 3. with image from Anderson et al., 2020
pterotic growth plate cartilage morphogenesis decreased process quality, abnormal lssnu60/nu60; nu101Tg standard conditions Fig. 5. with image from Anderson et al., 2020
Citations