CRISPR

CRISPR1-gba2

ID

ZDB-CRISPR-210317-5

Name

CRISPR1-gba2

Previous Names

None

Target

gba2 (1)

Sequence

5' - GGCGGAGGGAGCATCACTCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3253	gba2

Expression

Gene expression in Wild Types + CRISPR1-gba2

No data available

Phenotype

Phenotype resulting from CRISPR1-gba2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gba2

Phenotype	Fish	Conditions	Figures
whole organism gba1 expression decreased amount, abnormal	gba2^{zf3253/zf3253} (AB/TL)	control	Fig. 5 from Lelieveld et al., 2019
whole organism cholesteryl beta-D-glucoside decreased amount, abnormal	gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism glucosylceramide increased amount, abnormal	gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism gba2 expression absent, abnormal	gba2^{zf3253/zf3253} (AB/TL)	standard conditions	Fig. 3, Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism cholesteryl beta-D-glucoside decreased amount, abnormal	gba2^{zf3253/zf3253} (AB/TL)	standard conditions	Fig. 3, Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism gba2 expression absent, abnormal	gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism D-glucosylsphingosine increased amount, abnormal	gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism glucosylceramide increased amount, abnormal	gba2^{zf3253/zf3253} (AB/TL)	standard conditions	Fig. 3, Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism gba1 expression absent, abnormal	gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism gba1 expression decreased amount, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	control	Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism gba2 expression absent, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	control	Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism cholesteryl beta-D-glucoside decreased amount, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism gba2 expression absent, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism glucosylceramide increased amount, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism cholesteryl beta-D-glucoside decreased amount, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	control	Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism D-glucosylsphingosine increased amount, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	standard conditions	Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism glucosylceramide increased amount, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	standard conditions	Fig. 4, Fig. 5 from Lelieveld et al., 2019
whole organism D-glucosylsphingosine increased amount, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019
whole organism gba1 expression absent, abnormal	gba1^{zf3252/zf3252}; gba2^{zf3253/zf3253} (AB/TL)	chemical treatment: inhibitor	Fig. 5 from Lelieveld et al., 2019

Citations