CRISPR

CRISPR2-togaram1

ID

ZDB-CRISPR-210223-4

Name

CRISPR2-togaram1

Previous Names

None

Target

togaram1 (1)

Sequence

5' - GGTGAATCTGCGCGCTCTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 17

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zh508	togaram1
zh509	togaram1
zh510	togaram1

Expression

Gene expression in Wild Types + CRISPR2-togaram1

No data available

Phenotype

Phenotype resulting from CRISPR2-togaram1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-togaram1

Phenotype	Fish	Conditions	Figures
tectal ventricle cilium arl13b expression spatial pattern, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium arl13b expression spatial pattern, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium arl13b expression spatial pattern, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased length, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
kidney cystic, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
whole organism curved, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium decreased length, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium decreased amount, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased amount, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium arl13b expression spatial pattern, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium arl13b expression spatial pattern, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium arl13b expression spatial pattern, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased length, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium decreased amount, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
kidney cystic, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
whole organism curved, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium decreased length, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased amount, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium arl13b expression spatial pattern, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium arl13b expression spatial pattern, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium decreased amount, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased length, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium arl13b expression spatial pattern, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
kidney cystic, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium decreased length, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
whole organism curved, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased amount, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020

Citations

Include unpublished citations

Latour, B.L., Van De Weghe, J.C., Rusterholz, T.D., Letteboer, S.J., Gomez, A., Shaheen, R., Gesemann, M., Karamzade, A., Asadollahi, M., Barroso-Gil, M., Chitre, M., Grout, M.E., van Reeuwijk, J., van Beersum, S.E., Miller, C.V., Dempsey, J.C., Morsy, H., Bamshad, M.J., Nickerson, D.A., Neuhauss, S.C., Boldt, K., Ueffing, M., Keramatipour, M., Sayer, J.A., Alkuraya, F.S., Bachmann-Gagescu, R., Roepman, R., Doherty, D. (2020) Dysfunction of the ciliary ARMC9/TOGARAM1 protein module causes Joubert syndrome. The Journal of Clinical Investigation. 130(8):4423-4439

1 - 1 of 1

Show