CRISPR

CRISPR3-ypel3

ID
ZDB-CRISPR-210212-1
Name
CRISPR3-ypel3
Previous Names
None
Target
Sequence
5' - GGTGTTTTTAGGGTGAACGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
b1309 ypel3
b1310 ypel3
Expression
Gene expression in Wild Types + CRISPR3-ypel3
No data available
Phenotype
Phenotype resulting from CRISPR3-ypel3
No data available
Phenotype of all Fish created by or utilizing CRISPR3-ypel3
Phenotype Fish Conditions Figures
oligodendrocyte mbpb expression decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 4 with image from Blanco-Sánchez et al., 2020
peripheral nervous system nerve deformed, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 6 with image from Blanco-Sánchez et al., 2020
immature Schwann cell sox10 expression increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 5 with image from Blanco-Sánchez et al., 2020
myelinating Schwann cell decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 6 with image from Blanco-Sánchez et al., 2020
peripheral nervous system myelination disrupted, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 6 with image,  Fig. S2 Video from Blanco-Sánchez et al., 2020
central nervous system glioblast (sensu Vertebrata) decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 4 with image,  Fig s4 with image from Blanco-Sánchez et al., 2020
whole organism N-hexacosenoylsphingosine-1-phosphocholine increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
central nervous system glioblast (sensu Vertebrata) EGFP expression decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 4 with image from Blanco-Sánchez et al., 2020
myelinating Schwann cell associated with motor neuron axon, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 5 with image from Blanco-Sánchez et al., 2020
central nervous system glioblast (sensu Vertebrata) mRFP expression decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 4 with image from Blanco-Sánchez et al., 2020
whole organism 1-palmitoyl-2-[(4Z,7Z,10Z,13Z,16Z,19Z)-docosahexaenoyl]-sn-glycero-3-phosphate increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
whole organism N-pentacosanoylsphingosine-1-phosphocholine increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
myelinating Schwann cell increased size, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 5 with image from Blanco-Sánchez et al., 2020
oligodendrocyte filopodium decreased length, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig s4 with image from Blanco-Sánchez et al., 2020
oligodendrocyte decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 4 with image,  Fig s4 with image from Blanco-Sánchez et al., 2020
myelinating Schwann cell decreased thickness, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 6 with image from Blanco-Sánchez et al., 2020
whole organism N-hexacosanoylsphingosine-1-phosphocholine increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
swimming behavior disrupted, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
spinal cord mbpb expression absent, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
glioblast (sensu Vertebrata) mislocalised, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig. S2 Video from Blanco-Sánchez et al., 2020
peripheral nervous system nerve mbpb expression decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
peripheral nervous system nerve defasciculated, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 6 with image from Blanco-Sánchez et al., 2020
peripheral nervous system nerve increased size, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 6 with image from Blanco-Sánchez et al., 2020
whole organism N-pentacosanoylsphingosine increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
oligodendrocyte filopodium decreased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig s4 with image from Blanco-Sánchez et al., 2020
whole organism N-hexacosanoylsphingosine increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
whole organism 1,2-di[(4Z,7Z,10Z,13Z,16Z,19Z)-docosahexaenoyl]-sn-glycero-3-phosphate increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 7 with image from Blanco-Sánchez et al., 2020
peripheral nervous system glial cell (sensu Vertebrata) increased amount, abnormal ypel3b1310/b1310; vu16Tg; vu234Tg standard conditions Fig 6 with image from Blanco-Sánchez et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.