CRISPR

CRISPR3-thraa

ID

ZDB-CRISPR-200825-5

Name

CRISPR3-thraa

Previous Names

None

Target

thraa (1)

Sequence

5' - GGTCCCGCCGCTCTTCCTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were likely added to improve binding.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nci101	thraa
nci102	thraa

Expression

Gene expression in Wild Types + CRISPR3-thraa

No data available

Phenotype

Phenotype resulting from CRISPR3-thraa

No data available

Phenotype of all Fish created by or utilizing CRISPR3-thraa

Phenotype	Fish	Conditions	Figures
cardiac ventricle sarcomere decreased length, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
atrium dilated, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 1, Fig. 5 from Han et al., 2020
heart hbae1.1 expression increased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 2 from Han et al., 2020
cardiac ventricle sarcomere structurally discontinuous, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart mybpc3 expression increased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart heart contraction decreased rate, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 3 from Han et al., 2020
heart myh7 expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart ldb3a expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart slc8a1a expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 2 from Han et al., 2020
heart mypn expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart tnnt2a expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
blood decreased fluid flow, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 3, Fig. 5 from Han et al., 2020
heart smyd1b expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart actn2b expression increased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart nexn expression increased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart myh6 expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
heart atp2a2a expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 2 from Han et al., 2020
heart ab9-mapk labeling decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 2 from Han et al., 2020
heart Ab3-tnnt2 labeling decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 2 from Han et al., 2020
heart tcap expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 4 from Han et al., 2020
atrium displaced, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 1, Fig. 5 from Han et al., 2020
heart pln1 expression decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 2 from Han et al., 2020
heart Ab3-atp2a2 labeling decreased amount, abnormal	thraa^{nci102/nci102} (NHGRI-1)	standard conditions	Fig. 2 from Han et al., 2020

Citations