CRISPR

CRISPR2-cep55l

ID
ZDB-CRISPR-200812-2
Name
CRISPR2-cep55l
Previous Names
None
Target
Sequence
5' - CAATCAGCAGCTGCTGGGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uy25 cep55l
Expression
Gene expression in Wild Types + CRISPR2-cep55l
No data available
Phenotype
Phenotype resulting from CRISPR2-cep55l
No data available
Phenotype of all Fish created by or utilizing CRISPR2-cep55l
Phenotype Fish Conditions Figures
Meckel's cartilage anterior-posterior axis decreased distance ceratohyal cartilage, abnormal cep55luy25/uy25 standard conditions Fig. 3 from Yanagi et al., 2019
ventral mandibular arch dlx2a expression spatial pattern, abnormal cep55luy25/uy25 standard conditions Fig. 5 from Yanagi et al., 2019
retina morphology, abnormal cep55luy25/uy25 standard conditions Fig. 4 from Yanagi et al., 2019
brain dlx2a expression mislocalised, abnormal cep55luy25/uy25 standard conditions Fig. 5 from Yanagi et al., 2019
lens decreased diameter, abnormal cep55luy25/uy25 standard conditions Fig. 4 from Yanagi et al., 2019
cell death increased process quality, abnormal cep55luy25/uy25 standard conditions Fig. 2 from Yanagi et al., 2019
eye decreased size, abnormal cep55luy25/uy25 standard conditions Fig. 1 from Yanagi et al., 2019
retina decreased size, abnormal cep55luy25/uy25 standard conditions Fig. 3 from Yanagi et al., 2019
ventral mandibular arch disorganized, abnormal cep55luy25/uy25 standard conditions Fig. 1 from Yanagi et al., 2019
motor nucleus of vagal nerve EGFP expression spatial pattern, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
trochlear motor nucleus EGFP expression spatial pattern, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
motor nucleus of vagal nerve disorganized, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
spinal cord motor neuron EGFP expression spatial pattern, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
motor nucleus of vagal nerve decreased size, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
trigeminal motor nucleus decreased size, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
facial nerve motor nucleus decreased size, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
facial nerve motor nucleus disorganized, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
trochlear motor nucleus decreased size, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
facial nerve motor nucleus EGFP expression spatial pattern, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
trochlear motor nucleus disorganized, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
retina morphology, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
oculomotor nucleus disorganized, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
trigeminal motor nucleus EGFP expression spatial pattern, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
trigeminal motor nucleus disorganized, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
oculomotor nucleus EGFP expression spatial pattern, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
retina decreased size, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
oculomotor nucleus decreased size, abnormal cep55luy25/uy25; rw0Tg standard conditions Fig. 6 from Yanagi et al., 2019
cranial blood vessel EGFP expression spatial pattern, abnormal cep55luy25; y1Tg standard conditions Fig. 6 from Yanagi et al., 2019
cranial blood vessel disorganized, abnormal cep55luy25; y1Tg standard conditions Fig. 6 from Yanagi et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.