CRISPR

CRISPR1-gnrh3

ID
ZDB-CRISPR-200729-3
Name
CRISPR1-gnrh3
Previous Names
None
Target
Sequence
5' - GGAGTGGAAAGGAAGGTTGTTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This CRISPR contains the SNP rs508493814.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb605 gnrh3
Expression
Gene expression in Wild Types + CRISPR1-gnrh3
No data available
Phenotype
Phenotype resulting from CRISPR1-gnrh3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gnrh3
Phenotype Fish Conditions Figures
whole organism ab11-mapk labeling decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 7 from Feng et al., 2019
whole organism ab9-mapk labeling decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 7 from Feng et al., 2019
whole organism cyp19a1a expression decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
female organism fertilization decreased rate, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 2 from Feng et al., 2019
whole organism cyp11c1 expression increased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
whole organism cyp11c1 expression amount, ameliorated gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
male organism increased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 2 from Feng et al., 2019
whole organism cyp19a1a expression amount, ameliorated gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
whole organism amh expression increased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
primordial germ cell decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 3 from Feng et al., 2019
whole organism amh expression amount, ameliorated gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
whole organism nanos3 expression decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
whole organism ddx4 expression decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
brain gnrh3 expression decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 1 from Feng et al., 2019
primordial germ cell ddx4 expression decreased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 3 from Feng et al., 2019
whole organism sox9a expression increased amount, abnormal gnrh3ihb605/ihb605 standard conditions Fig. 8 from Feng et al., 2019
Citations