CRISPR

CRISPR1-rgp1

ID
ZDB-CRISPR-200720-2
Name
CRISPR1-rgp1
Previous Names
None
Target
Sequence
5' - GGTGGTGGCATCTATGGCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
vmc4 rgp1
vmc5 rgp1
vmc6 rgp1
Expression
Gene expression in Wild Types + CRISPR1-rgp1
No data available
Phenotype
Phenotype resulting from CRISPR1-rgp1
Phenotype of all Fish created by or utilizing CRISPR1-rgp1
Phenotype Fish Conditions Figures
whole organism arf4b expression increased amount, abnormal rgp1vmc4/vmc4 (AB) standard conditions Figure 6 with image from Ritter et al., 2023
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal rgp1vmc4/vmc4 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
Meckel's cartilage decreased length, abnormal rgp1vmc4/vmc4 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
head decreased length, abnormal rgp1vmc4/vmc4 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
mandibular arch skeleton decreased length, abnormal rgp1vmc4/vmc4 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
whole organism arf4b expression increased amount, abnormal rgp1vmc5/vmc5 (AB) standard conditions Figure 6 with image from Ritter et al., 2023
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal rgp1vmc5/vmc5 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
Meckel's cartilage decreased length, abnormal rgp1vmc5/vmc5 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
head decreased length, abnormal rgp1vmc5/vmc5 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
mandibular arch skeleton decreased length, abnormal rgp1vmc5/vmc5 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
whole organism arf4b expression increased amount, abnormal rgp1vmc6/vmc6 (AB) standard conditions Figure 6 with image from Ritter et al., 2023
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal rgp1vmc6/vmc6 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
Meckel's cartilage decreased length, abnormal rgp1vmc6/vmc6 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
head decreased length, abnormal rgp1vmc6/vmc6 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
mandibular arch skeleton decreased length, abnormal rgp1vmc6/vmc6 (AB) standard conditions Figure 1 with image from Ritter et al., 2023
head flattened, abnormal AB + CRISPR1-rgp1 standard conditions Fig. Ext Fig 9 from Unlu et al., 2020
head decreased length, abnormal AB + CRISPR1-rgp1 standard conditions Fig. Ext Fig 9 from Unlu et al., 2020
Meckel's cartilage decreased length, abnormal AB + CRISPR1-rgp1 standard conditions Fig. Ext Fig 9 from Unlu et al., 2020
Meckel's cartilage malformed, abnormal AB + CRISPR1-rgp1 standard conditions Fig. Ext Fig 9 from Unlu et al., 2020
chondrocyte Collagen increased amount, abnormal AB + CRISPR1-rgp1 standard conditions Fig. 5 from Unlu et al., 2020
ceratohyal cartilage decreased length, abnormal AB + CRISPR1-rgp1 standard conditions Fig. Ext Fig 9 from Unlu et al., 2020
whole organism decreased length, abnormal AB + CRISPR1-rgp1 standard conditions Fig. Ext Fig 9 from Unlu et al., 2020
chondrocyte extracellular matrix organization disrupted, abnormal AB + CRISPR1-rgp1 standard conditions Fig. 5,  Fig. Ext Fig 9 from Unlu et al., 2020
chondrocyte vacuole increased amount, abnormal rgp1vmc4/vmc4; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte endolysosome accumulation chondrocyte collagen type II trimer, abnormal rgp1vmc4/vmc4; vmc7Tg (AB) standard conditions Figure 4 with image from Ritter et al., 2023
chondrocyte cytoplasm ab1-col2a labeling increased distribution, abnormal rgp1vmc4/vmc4; vmc7Tg (AB) standard conditions Figure 3 with image from Ritter et al., 2023
chondrocyte apoptotic process increased process quality, abnormal rgp1vmc4/vmc4; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte extracellular region ab1-col2a labeling decreased distribution, abnormal rgp1vmc4/vmc4; vmc7Tg (AB) standard conditions Figure 3 with image from Ritter et al., 2023
chondrocyte nucleus condensed, abnormal rgp1vmc4/vmc4; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte endolysosome accumulation chondrocyte collagen type II trimer, abnormal rgp1vmc5/vmc5; vmc7Tg (AB) standard conditions Figure 4 with image from Ritter et al., 2023
chondrocyte vacuole increased amount, abnormal rgp1vmc5/vmc5; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte cytoplasm ab1-col2a labeling increased distribution, abnormal rgp1vmc5/vmc5; vmc7Tg (AB) standard conditions Figure 3 with image from Ritter et al., 2023
chondrocyte apoptotic process increased process quality, abnormal rgp1vmc5/vmc5; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte nucleus condensed, abnormal rgp1vmc5/vmc5; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte extracellular region ab1-col2a labeling decreased distribution, abnormal rgp1vmc5/vmc5; vmc7Tg (AB) standard conditions Figure 3 with image from Ritter et al., 2023
chondrocyte endolysosome accumulation chondrocyte collagen type II trimer, abnormal rgp1vmc6/vmc6; vmc7Tg (AB) standard conditions Figure 4 with image from Ritter et al., 2023
chondrocyte vacuole increased amount, abnormal rgp1vmc6/vmc6; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte cytoplasm ab1-col2a labeling increased distribution, abnormal rgp1vmc6/vmc6; vmc7Tg (AB) standard conditions Figure 3 with image from Ritter et al., 2023
chondrocyte apoptotic process increased process quality, abnormal rgp1vmc6/vmc6; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte nucleus condensed, abnormal rgp1vmc6/vmc6; vmc7Tg (AB) standard conditions Figure 6 with image from Ritter et al., 2023
chondrocyte extracellular region ab1-col2a labeling decreased distribution, abnormal rgp1vmc6/vmc6; vmc7Tg (AB) standard conditions Figure 3 with image from Ritter et al., 2023
Citations