Community Action Needed: Please respond to the NIH RFI
CRISPR

CRISPR1-myo10l1

ID
ZDB-CRISPR-200312-1
Name
CRISPR1-myo10l1
Previous Names
  • CRISPR Myo10l1 A (1)
Target
Sequence
5' - GGTGGTGTACCTGCAGCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-myo10l1
No data available
Phenotype
Phenotype resulting from CRISPR1-myo10l1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-myo10l1
Citations