CRISPR

CRISPR1-epg5

ID
ZDB-CRISPR-200128-14
Name
CRISPR1-epg5
Previous Names
None
Target
Sequence
5' - TGAGGTCAGGAGGCACATGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ia31 epg5
Expression
Gene expression in Wild Types + CRISPR1-epg5
No data available
Phenotype
Phenotype resulting from CRISPR1-epg5
No data available
Phenotype of all Fish created by or utilizing CRISPR1-epg5
Phenotype Fish Conditions Figures
myocardium condensed, abnormal epg5ia31/ia31 standard conditions Fig. S5 from Meneghetti et al., 2019
intestine somatic stem cell decreased amount, abnormal epg5ia31/ia31 standard conditions Fig. 5 from Meneghetti et al., 2019
intestine chordoma increased amount, abnormal epg5ia31/ia31 standard conditions Fig. S10 from Meneghetti et al., 2019
heart morphology, abnormal epg5ia31/ia31 standard conditions Fig. 8 from Meneghetti et al., 2019
sperm decreased amount, abnormal epg5ia31/ia31 standard conditions Fig. S7 from Meneghetti et al., 2019
whole organism decreased female fertility, abnormal epg5ia31/ia31 standard conditions Fig. S8 from Meneghetti et al., 2019
whole organism decreased length, abnormal epg5ia31/ia31 standard conditions Fig. 7 from Meneghetti et al., 2019
whole organism Ab9-map1lc3b labeling increased amount, abnormal epg5ia31/ia31 fasting Fig. 4 from Meneghetti et al., 2019
oocyte stage IV decreased amount, abnormal epg5ia31/ia31 standard conditions Fig. 8 from Meneghetti et al., 2019
intestine apoptotic process increased occurrence, abnormal epg5ia31/ia31 standard conditions Fig. 5 from Meneghetti et al., 2019
liver increased size, abnormal epg5ia31/ia31 standard conditions Fig. S11 from Meneghetti et al., 2019
testis morphology, abnormal epg5ia31/ia31 standard conditions Fig. 8Fig. S7 from Meneghetti et al., 2019
intestinal mucosa morphology, abnormal epg5ia31/ia31 standard conditions Fig. S9 from Meneghetti et al., 2019
intestine mitochondrion swollen, abnormal epg5ia31/ia31 standard conditions Fig. 6 from Meneghetti et al., 2019
ovary decreased size, abnormal epg5ia31/ia31 standard conditions Fig. S11 from Meneghetti et al., 2019
oocyte stage II decreased amount, abnormal epg5ia31/ia31 standard conditions Fig. 8 from Meneghetti et al., 2019
nucleate erythrocyte aggregated, abnormal epg5ia31/ia31 standard conditions Fig. S5 from Meneghetti et al., 2019
oocyte atretic, abnormal epg5ia31/ia31 standard conditions Fig. S6Fig. S11 from Meneghetti et al., 2019
skeletal muscle refractivity, abnormal epg5ia31/ia31 fasting Fig. 4 from Meneghetti et al., 2019
seminiferous tubule morphology, abnormal epg5ia31/ia31 standard conditions Fig. 8 from Meneghetti et al., 2019
skeletal muscle mitochondrial outer membrane dilated, abnormal epg5ia31/ia31 standard conditions Fig. 3 from Meneghetti et al., 2019
whole organism decreased male fertility, abnormal epg5ia31/ia31 standard conditions Fig. S8 from Meneghetti et al., 2019
ovarian follicle development disrupted, abnormal epg5ia31/ia31 standard conditions Fig. 8Fig. S6 from Meneghetti et al., 2019
oocyte stage III decreased amount, abnormal epg5ia31/ia31 standard conditions Fig. 8 from Meneghetti et al., 2019
autophagy disrupted, abnormal epg5ia31/ia31 standard conditions Fig. 3 from Meneghetti et al., 2019
skeletal muscle autophagosome increased amount, abnormal epg5ia31/ia31 standard conditions Fig. 3 from Meneghetti et al., 2019
trabecular layer morphology, abnormal epg5ia31/ia31 standard conditions Fig. 8Fig. S5 from Meneghetti et al., 2019
oocyte stage V decreased amount, abnormal epg5ia31/ia31 standard conditions Fig. 8 from Meneghetti et al., 2019
testis fibrotic, abnormal epg5ia31/ia31 standard conditions Fig. 8Fig. S7 from Meneghetti et al., 2019
intestinal epithelium degenerate, abnormal epg5ia31/ia31 standard conditions Fig. S9 from Meneghetti et al., 2019
goblet cell mucin granule dense, abnormal epg5ia31/ia31 standard conditions Fig. 6 from Meneghetti et al., 2019
skeletal muscle autophagosome increased amount, abnormal epg5ia31/ia31 fasting Fig. 4 from Meneghetti et al., 2019
trunk decreased length, abnormal epg5ia31/ia31 standard conditions Fig. 7 from Meneghetti et al., 2019
myocardium decreased thickness, abnormal epg5ia31/ia31 standard conditions Fig. 8Fig. S5 from Meneghetti et al., 2019
goblet cell decreased area, abnormal epg5ia31/ia31 standard conditions Fig. S2 from Meneghetti et al., 2019
goblet cell decreased amount, abnormal epg5ia31/ia31 standard conditions Fig. 5Fig. S2 from Meneghetti et al., 2019
oocyte stage I increased amount, abnormal epg5ia31/ia31 standard conditions Fig. 8 from Meneghetti et al., 2019
intestinal stem cell homeostasis disrupted, abnormal epg5ia31/ia31 standard conditions Fig. 5 from Meneghetti et al., 2019
whole organism lysosome EGFP expression increased amount, abnormal epg5ia31/ia31 ; mw7Tg standard conditions Fig. 9 from Meneghetti et al., 2019
whole organism endosome EGFP expression increased amount, abnormal epg5ia31/ia31 ; mw7Tg standard conditions Fig. 9 from Meneghetti et al., 2019
autophagosome-lysosome fusion disrupted, abnormal epg5ia31/ia31 ; mw7Tg standard conditions Fig. 9 from Meneghetti et al., 2019
whole organism autophagosome membrane RFP expression increased amount, abnormal pd1064Tg ; epg5ia31/ia31 standard conditions Fig. 9 from Meneghetti et al., 2019
autophagosome-lysosome fusion disrupted, abnormal pd1064Tg ; epg5ia31/ia31 standard conditions Fig. 9 from Meneghetti et al., 2019
autophagosome-lysosome fusion disrupted, abnormal pd1065Tg ; epg5ia31/ia31 standard conditions Fig. 9 from Meneghetti et al., 2019
Citations