CRISPR

CRISPR1-hhex

ID
ZDB-CRISPR-200127-6
Name
CRISPR1-hhex
Previous Names
None
Target
Sequence
5' - GGAAGAACCGGGAGCTCCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zju16 hhex
zju17 hhex
zko2671A hhex
Expression
Gene expression in Wild Types + CRISPR1-hhex
No data available
Phenotype
Phenotype resulting from CRISPR1-hhex
No data available
Phenotype of all Fish created by or utilizing CRISPR1-hhex
Phenotype Fish Conditions Figures
digestive system duct sox9b expression absent, abnormal hhexzju16/zju16 standard conditions Fig. 8 from Gao et al., 2018
liver decreased size, abnormal hhexzju16/zju16 standard conditions Fig. 1 from Gao et al., 2018
pancreatic duct pdx1 expression absent, abnormal hhexzju16/zju16 standard conditions Fig. 6 from Gao et al., 2018
intestine left side pdx1 expression mislocalised, abnormal hhexzju16/zju16 standard conditions Fig. 6 from Gao et al., 2018
intestinal bulb cdx1b expression spatial pattern, abnormal hhexzju16/zju16 standard conditions Fig. 6 from Gao et al., 2018
exocrine pancreas prss1 expression absent, abnormal hhexzju16/zju16 standard conditions Fig. 1 from Gao et al., 2018
gall bladder duct ab-2f11 labeling absent, abnormal hhexzju16/zju16 standard conditions Fig. 4 from Gao et al., 2018
liver fabp10a expression decreased distribution, abnormal hhexzju16/zju16 standard conditions Fig. 1 from Gao et al., 2018
intestinal bulb primordium cdx1b expression spatial pattern, abnormal hhexzju16/zju16 standard conditions Fig. 6 from Gao et al., 2018
hepatic duct ab-2f11 labeling absent, abnormal hhexzju16/zju16 standard conditions Fig. 4 from Gao et al., 2018
extrahepatic duct ab-2f11 labeling absent, abnormal hhexzju16/zju16 standard conditions Fig. 4 from Gao et al., 2018
intrahepatic bile duct intestine lumen fabp2 expression mislocalised, abnormal hhexzju16/zju16 standard conditions Fig. 4 from Gao et al., 2018
gall bladder duct absent, abnormal hhexzju16/zju16 standard conditions Fig. 4 from Gao et al., 2018
exocrine pancreas absent, abnormal hhexzju16/zju16 standard conditions Fig. 1 from Gao et al., 2018
intestinal bulb primordium hhex expression absent, abnormal hhexzju16/zju16 standard conditions Fig. 6 from Gao et al., 2018
liver prox1a expression decreased distribution, abnormal hhexzju16/zju16 standard conditions Fig. 1 from Gao et al., 2018
liver pdx1 expression mislocalised, abnormal hhexzju16/zju16 standard conditions Fig. 6Fig. 8 from Gao et al., 2018
liver primordium pdx1 expression mislocalised, abnormal hhexzju16/zju16 standard conditions Fig. 6 from Gao et al., 2018
extrahepatic duct absent, abnormal hhexzju16/zju16 standard conditions Fig. 4 from Gao et al., 2018
liver decreased size, abnormal hhexzju17/zju17 standard conditions Fig. S1 from Gao et al., 2018
exocrine pancreas absent, abnormal hhexzju17/zju17 standard conditions Fig. S1 from Gao et al., 2018
liver morphology, abnormal hhexzju16/zju16; gz15Tg standard conditions Fig. 3 from Gao et al., 2018
intrahepatic bile duct intestine lumen EGFP expression mislocalised, abnormal hhexzju16/zju16; zf3097Tg standard conditions Fig. 4 from Gao et al., 2018
liver EGFP expression mislocalised, abnormal hhexzju16/zju16; zf3097Tg standard conditions Fig. 4 from Gao et al., 2018
liver morphology, abnormal hhexzju16/zju16; zju18Tg standard conditions Fig. 3Fig. S2 from Gao et al., 2018
Citations