CRISPR

CRISPR1-kdr

ID

ZDB-CRISPR-200123-7

Name

CRISPR1-kdr

Previous Names

None

Target

kdr (1)

Sequence

5' - AGATCACCTCTTTCCCATCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 20

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uq38bh	kdr

Expression

Gene expression in Wild Types + CRISPR1-kdr

No data available

Phenotype

Phenotype resulting from CRISPR1-kdr

No data available

Phenotype of all Fish created by or utilizing CRISPR1-kdr

Phenotype	Fish	Conditions	Figures
medial facial lymph vessel lacks parts or has fewer parts of type endothelial cell, abnormal	kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
medial facial lymph vessel has fewer parts of type endothelial cell, abnormal	kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 4 from Vogrin et al., 2019
lateral facial lymph vessel has fewer parts of type endothelial cell, abnormal	kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 4 from Vogrin et al., 2019
otolithic lymph vessel lacks parts or has fewer parts of type endothelial cell, abnormal	kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
lateral facial lymph vessel lacks parts or has fewer parts of type endothelial cell, abnormal	kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
otolithic lymph vessel has fewer parts of type endothelial cell, abnormal	kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 4 from Vogrin et al., 2019
cranial vasculature vascular lymphangioblast ab5-prox1 labeling decreased amount, abnormal	kdr^{uq38bh/uq38bh}; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
medial facial lymph vessel has fewer parts of type endothelial cell, abnormal	flt4^hu4602/+; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
otolithic lymph vessel has fewer parts of type endothelial cell, abnormal	flt4^hu4602/+; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
lateral facial lymph vessel has fewer parts of type endothelial cell, abnormal	flt4^hu4602/+; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
thoracic duct has fewer parts of type endothelial cell, abnormal	flt4^hu4602/+; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 4 from Vogrin et al., 2019
thoracic duct absent, abnormal	flt4^hu4602/+; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 4 from Vogrin et al., 2019
lateral facial lymph vessel absent, abnormal	flt4^hu4602/+; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
otolithic lymph vessel absent, abnormal	flt4^hu4602/+; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
medial facial lymph vessel absent, abnormal	flt4^hu4602/+; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
otolithic lymph vessel absent, abnormal	flt4^{hu4602/hu4602}; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
lateral facial lymph vessel absent, abnormal	flt4^{hu4602/hu4602}; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
medial facial lymph vessel absent, abnormal	flt4^{hu4602/hu4602}; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
thoracic duct absent, abnormal	flt4^{hu4602/hu4602}; kdr^uq38bh/+; nz101Tg; y7Tg	standard conditions	Fig. 4 from Vogrin et al., 2019
otolithic lymph vessel absent, abnormal	flt4^{hu4602/hu4602}; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
medial facial lymph vessel absent, abnormal	flt4^{hu4602/hu4602}; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
lateral facial lymph vessel absent, abnormal	flt4^{hu4602/hu4602}; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
thoracic duct absent, abnormal	flt4^{hu4602/hu4602}; kdr^{uq38bh/uq38bh}; nz101Tg; y7Tg	standard conditions	Fig. 4 from Vogrin et al., 2019
common cardinal vein nucleus ab5-prox1 labeling decreased amount, abnormal	flt4^{hu4602/hu4602}; kdr^{uq38bh/uq38bh}; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019
cranial vasculature vascular lymphangioblast ab5-prox1 labeling decreased amount, abnormal	flt4^{hu4602/hu4602}; kdr^{uq38bh/uq38bh}; y7Tg	standard conditions	Fig. 5 from Vogrin et al., 2019

Citations

Include unpublished citations

Vogrin, A.J., Bower, N.I., Gunzburg, M.J., Roufail, S., Okuda, K.S., Paterson, S., Headey, S.J., Stacker, S.A., Hogan, B.M., Achen, M.G. (2019) Evolutionary Differences in the Vegf/Vegfr Code Reveal Organotypic Roles for the Endothelial Cell Receptor Kdr in Developmental Lymphangiogenesis. Cell Reports. 28:2023-2036.e4

1 - 1 of 1

Show