CRISPR

CRISPR1-scxb

ID
ZDB-CRISPR-191227-4
Name
CRISPR1-scxb
Previous Names
None
Target
Sequence
5' - GGCTATGGTTCCTTTAAGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
kg107 scxb
Expression
Gene expression in Wild Types + CRISPR1-scxb
No data available
Phenotype
Phenotype resulting from CRISPR1-scxb
No data available
Phenotype of all Fish created by or utilizing CRISPR1-scxb
Phenotype Fish Conditions Figures
vertical myoseptum muscle tendon junction xirp2a expression decreased amount, abnormal scxbkg107/kg107 (AB) standard conditions Fig. 6 with image from Kague et al., 2019
interhyoideus skeletal muscle cell increased length, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
splanchnocranium skeletal muscle tissue development decreased process quality, exacerbated scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral intermandibularis posterior skeletal muscle cell mislocalised, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral intermandibularis posterior tendon Ab4-thbs4b labeling decreased amount, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
interhyoideus tendon Ab4-thbs4b labeling decreased amount, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral mandibular arch paralysed, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
adductor mandibulae tendon Ab4-thbs4b labeling decreased amount, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
splanchnocranium tendon development decreased process quality, exacerbated scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
interhyoideus skeletal muscle cell mislocalised, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral intermandibularis posterior skeletal muscle cell increased length, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte undifferentiated, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage malformed, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte obtuse, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte differentiation decreased process quality, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral mandibular arch paralysed, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte immature, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
whole organism lethal (sensu genetics), abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage drooping, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Citations