CRISPR
CRISPR1-fcer1g
- ID
- ZDB-CRISPR-190125-3
- Name
- CRISPR1-fcer1g
- Previous Names
- None
- Target
- Sequence
-
5' - GGCAGATGCGATGAGTCTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The first "G" was likely added to improve binding.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-fcer1g
No data available
Phenotype
Phenotype resulting from CRISPR1-fcer1g
No data available
Phenotype of all Fish created by or utilizing CRISPR1-fcer1g
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| angiogenesis increased occurrence, ameliorated | s843Tg + CRISPR1-fcer1g + CRISPR1-fcer1gl | chemical treatment by injection: trehalose 6,6'-dimycolate |
Fig. S3
from Walton et al., 2018 |
Citations