CRISPR

CRISPR1-plpbp

ID

ZDB-CRISPR-181019-3

Name

CRISPR1-plpbp

Previous Names

None

Target

plpbp (1)

Sequence

5' - GGTGGAGCGGGTGAATCAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ot101	plpbp
ot102	plpbp

Expression

Gene expression in Wild Types + CRISPR1-plpbp

No data available

Phenotype

Phenotype resulting from CRISPR1-plpbp

No data available

Phenotype of all Fish created by or utilizing CRISPR1-plpbp

Phenotype	Fish	Conditions	Figures
whole organism swimming behavior increased process quality, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 4 from Johnstone et al., 2019
whole organism alpha-aminobutyric acid decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism isoleucine increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
optic tectum synaptic signaling ictal, ameliorated	plpbp^ot101/+; plpbp^ot102/+	chemical treatment by environment: pyridoxine	Fig. 5 from Johnstone et al., 2019
whole organism 3-aminoisobutyric acid increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism beta-alanine increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism tyrosine increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism dead, ameliorated	plpbp^ot101/+; plpbp^ot102/+	chemical treatment by environment: pyridoxal 5'-phosphate	Fig. 5 from Johnstone et al., 2019
whole organism dead, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 4 from Johnstone et al., 2019
whole organism lysine decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism phenylalanine increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism pyridoxal decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism fosab expression increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 4 from Johnstone et al., 2019
whole organism decreased life span, ameliorated	plpbp^ot101/+; plpbp^ot102/+	chemical treatment by environment: pyridoxine	Fig. 5 from Johnstone et al., 2019
whole organism methionine increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism tryptophan increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism decreased life span, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 4 from Johnstone et al., 2019
whole organism gamma-aminobutyric acid decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism decreased life span, ameliorated	plpbp^ot101/+; plpbp^ot102/+	chemical treatment by environment: pyridoxal 5'-phosphate	Fig. 5 from Johnstone et al., 2019
brain synaptic signaling ictal, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 4 from Johnstone et al., 2019
whole organism asparagine decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism proline decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism swimming behavior increased process quality, ameliorated	plpbp^ot101/+; plpbp^ot102/+	chemical treatment by environment: pyridoxine	Fig. 5 from Johnstone et al., 2019
whole organism cystathionine increased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism threonine decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism alanine decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism dead, ameliorated	plpbp^ot101/+; plpbp^ot102/+	chemical treatment by environment: pyridoxine	Fig. 5 from Johnstone et al., 2019
whole organism glutamine decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019
whole organism pyridoxal 5'-phosphate decreased amount, abnormal	plpbp^ot101/+; plpbp^ot102/+	standard conditions	Fig. 6 from Johnstone et al., 2019

Citations