CRISPR

CRISPR1-cbsb

ID

ZDB-CRISPR-180727-9

Name

CRISPR1-cbsb

Previous Names

None

Target

cbsb (1)

Sequence

5' - GGCTCAATGATGGTGTCTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mw207	cbsb

Expression

Gene expression in Wild Types + CRISPR1-cbsb

No data available

Phenotype

Phenotype resulting from CRISPR1-cbsb

Phenotype	Fish	Figures
whole organism Ab2-cbs labeling decreased amount, abnormal	WT + CRISPR1-cbsb	Fig. 4 from Dey et al., 2020
whole organism Ab4-hif1a labeling increased amount, abnormal	WT + CRISPR1-cbsb	Fig. 4 from Dey et al., 2020

Phenotype of all Fish created by or utilizing CRISPR1-cbsb

Phenotype	Fish	Conditions	Figures
head edematous, abnormal	cbsb^mw207/mw207	chemical treatment by environment: amino-acid betaine	Fig. 6 from Prabhudesai et al., 2018
brain homocysteine increased amount, abnormal	cbsb^mw207/mw207	standard conditions	Fig. S7 from Prabhudesai et al., 2018
axis elongation disrupted, abnormal	cbsb^mw207/mw207	standard conditions	Fig. 5 from Prabhudesai et al., 2018
whole organism anterior-posterior axis length, ameliorated	cbsb^mw207/mw207	chemical treatment by environment: amino-acid betaine	Fig. 6 from Prabhudesai et al., 2018
whole organism anterior-posterior axis bent, abnormal	cbsb^mw207/mw207	standard conditions	Fig. 5 from Prabhudesai et al., 2018
whole organism anterior-posterior axis shortened, abnormal	cbsb^mw207/mw207	standard conditions	Fig. 5 from Prabhudesai et al., 2018
whole organism Ab2-cbs labeling decreased amount, abnormal	WT + CRISPR1-cbsb	standard conditions	Fig. 4 from Dey et al., 2020
whole organism Ab4-hif1a labeling increased amount, abnormal	WT + CRISPR1-cbsb	standard conditions	Fig. 4 from Dey et al., 2020
whole organism Ab2-cbs labeling decreased amount, abnormal	WT + CRISPR1-cbsb	chemical treatment by environment: hydrogen sulfide	Fig. 4 from Dey et al., 2020
whole organism Ab4-hif1a labeling amount, ameliorated	WT + CRISPR1-cbsb	chemical treatment by environment: hydrogen sulfide	Fig. 4 from Dey et al., 2020
axis bent, ameliorated	mitfa^w2/w2; cbsb^mw207/mw207; mpv17^a9/a9; la116Tg	chemical treatment by environment: hydrogen sulfide	Fig. 4 from Dey et al., 2020
axis decreased length, ameliorated	mitfa^w2/w2; cbsb^mw207/mw207; mpv17^a9/a9; la116Tg	chemical treatment by environment: hydrogen sulfide	Fig. 4 from Dey et al., 2020
intersegmental vessel morphology, ameliorated	mitfa^w2/w2; cbsb^mw207/mw207; mpv17^a9/a9; la116Tg	chemical treatment by environment: hydrogen sulfide	Fig. 4 from Dey et al., 2020
axis decreased length, abnormal	mitfa^w2/w2; cbsb^mw207/mw207; mpv17^a9/a9; la116Tg	standard conditions	Fig. 4 from Dey et al., 2020
intersegmental vessel morphology, abnormal	mitfa^w2/w2; cbsb^mw207/mw207; mpv17^a9/a9; la116Tg	standard conditions	Fig. 4 from Dey et al., 2020
axis bent, abnormal	mitfa^w2/w2; cbsb^mw207/mw207; mpv17^a9/a9; la116Tg	standard conditions	Fig. 4 from Dey et al., 2020

Citations