CRISPR
CRISPR2-hif1al
- ID
- ZDB-CRISPR-180620-1
- Name
- CRISPR2-hif1al
- Previous Names
-
- CRISPR1-hif3a (1)
- Target
- Sequence
-
5' - GGACAAAGCTGCCATCATGAGGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
| Genomic Feature | Affected Genomic Regions |
|---|---|
| ihb20180620 | hif1al |
Expression
Gene expression in Wild Types + CRISPR2-hif1al
No data available
Phenotype
Phenotype resulting from CRISPR2-hif1al
No data available
Phenotype of all Fish created by or utilizing CRISPR2-hif1al
Citations