CRISPR

CRISPR1-znf408

ID
ZDB-CRISPR-180530-1
Name
CRISPR1-znf408
Previous Names
None
Target
Sequence
5' - GAGTCCACCGAGAGATCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
rmc102 znf408
rmc103 znf408
rmc104 znf408
rmc105 znf408
Expression
Gene expression in Wild Types + CRISPR1-znf408
No data available
Phenotype
Phenotype resulting from CRISPR1-znf408
No data available
Phenotype of all Fish created by or utilizing CRISPR1-znf408
Phenotype Fish Conditions Figures
photoreceptor outer segment layer increased length, abnormal znf408rmc105/rmc105(TL) standard conditions Fig. 3 with image from Karjosukarso et al., 2020
response to light stimulus increased behavioural activity, abnormal znf408rmc105/+(TL) standard conditions Fig. 5 from Karjosukarso et al., 2020
retina blood vessel has extra parts of type angiogenic sprout, abnormal znf408rmc103/rmc103; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
hyaloid vessel decreased amount, abnormal znf408rmc103/rmc103; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
retina blood vessel hemorrhagic, abnormal znf408rmc103/rmc103; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
retina blood vessel has extra parts of type angiogenic sprout, abnormal znf408rmc104/rmc104; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
hyaloid vessel decreased amount, abnormal znf408rmc104/rmc104; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
retina blood vessel hemorrhagic, abnormal znf408rmc104/rmc104; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
hyaloid vessel decreased amount, abnormal znf408rmc105/+; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
hyaloid vessel decreased amount, abnormal znf408rmc105/rmc105; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
retina blood vessel has extra parts of type angiogenic sprout, abnormal znf408rmc105/rmc105; la116Tg(TL) standard conditions Fig. 4 with image from Karjosukarso et al., 2020
Citations