CRISPR

CRISPR1-rmrp

ID
ZDB-CRISPR-180213-270
Name
CRISPR1-rmrp
Previous Names
  • CRISPR1-unm_zko737a
Target
Sequence
5' - GGGGAAAGTCCCCGGACACT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3563 rmrp
zko737a rmrp
Expression
Gene expression in Wild Types + CRISPR1-rmrp
No data available
Phenotype
Phenotype resulting from CRISPR1-rmrp
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rmrp
Phenotype Fish Conditions Figures
pharyngeal arch tp53 expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
intestine mdm2 expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
ventral mandibular arch decreased size, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3,  Fig. 8 from Sun et al., 2019
opercle intramembranous ossification delayed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 5 from Sun et al., 2019
basihyal cartilage col2a1a expression absent, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
whole organism increased length, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3 from Sun et al., 2019
eye decreased size, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3 from Sun et al., 2019
pharyngeal arch chondrocyte col2a1a expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
branchiostegal ray intramembranous ossification delayed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 5 from Sun et al., 2019
ceratohyal cartilage decreased length, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4,  Fig. 8 from Sun et al., 2019
ceratobranchial 5 bone bone mineralization delayed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
ventral mandibular arch malformed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3,  Fig. 8 from Sun et al., 2019
opercle bone mineralization involved in bone maturation decreased process quality, abnormal rmrpzf3563/zf3563 standard conditions Fig. 5 from Sun et al., 2019
ceratohyal cartilage length, ameliorated rmrpzf3563/zf3563 chemical treatment by environment: XAV939 Fig. 8 from Sun et al., 2019
vertebra ossification involved in bone maturation increased process quality, abnormal rmrpzf3563/zf3563 control Fig. 5,  Fig. 8 from Sun et al., 2019
ceratohyal cartilage Ab2-axin2 labeling increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 7 from Sun et al., 2019
intestine tp53 expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
head cell population proliferation decreased occurrence, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
pharyngeal arch cartilage ccnd1 expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 7 from Sun et al., 2019
whole organism wnt2bb expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 7 from Sun et al., 2019
ceratohyal cartilage perichondral ossification delayed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 5 from Sun et al., 2019
ceratobranchial 5 tooth tooth mineralization delayed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
whole organism rmrp expression decreased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3 from Sun et al., 2019
pleuroperitoneal region lacks all parts of type swim bladder, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3 from Sun et al., 2019
vertebra ossification involved in bone maturation process quality, ameliorated rmrpzf3563/zf3563 chemical treatment by environment: XAV939 Fig. 8 from Sun et al., 2019
ceratohyal cartilage malformed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4,  Fig. 8 from Sun et al., 2019
heart edematous, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3 from Sun et al., 2019
eye tp53 expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
whole organism canonical Wnt signaling pathway increased process quality, abnormal rmrpzf3563/zf3563 standard conditions Fig. 7 from Sun et al., 2019
dentary intramembranous ossification delayed, abnormal rmrpzf3563/zf3563 standard conditions Fig. 5 from Sun et al., 2019
intestine decreased size, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3,  Fig. 5 from Sun et al., 2019
ventral mandibular arch morphology, ameliorated rmrpzf3563/zf3563 chemical treatment by environment: XAV939 Fig. 8 from Sun et al., 2019
ceratohyal cartilage morphology, ameliorated rmrpzf3563/zf3563 chemical treatment by environment: XAV939 Fig. 8 from Sun et al., 2019
whole organism Ab17-ctnnb labeling increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 7 from Sun et al., 2019
ventral mandibular arch size, ameliorated rmrpzf3563/zf3563 chemical treatment by environment: XAV939 Fig. 8 from Sun et al., 2019
ceratohyal cartilage chondrocyte disorganized, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
whole organism wnt5b expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 7 from Sun et al., 2019
pharyngeal arch mdm2 expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
intestine hypoplastic, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3,  Fig. 5 from Sun et al., 2019
pharyngeal arch chondrocyte sox9a expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
Meckel's cartilage chondrocyte disorganized, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
eye mdm2 expression increased amount, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
head apoptotic process increased occurrence, abnormal rmrpzf3563/zf3563 standard conditions Fig. 6 from Sun et al., 2019
intestine smooth, abnormal rmrpzf3563/zf3563 standard conditions Fig. 3,  Fig. 5 from Sun et al., 2019
ceratohyal cartilage lateral orientation, abnormal rmrpzf3563/zf3563 standard conditions Fig. 4 from Sun et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.