ZFIN ID: ZDB-CRISPR-180208-2
CRISPR Name: CRISPR4-pax2a
Target: pax2a (1)
Source:
Target Sequence:
5' - GGGGGGATCTGGGAAGGAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This CRISPR was designed to target approximately 500 base pairs upstream of the ATG start site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR4-pax2a No data available
GENOMIC FEATURES CREATED WITH CRISPR4-pax2a
Genomic Feature Affected Genomic Regions    
tud42Tg    
tud43Tg    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR4-pax2a No data available
PHENOTYPE
Phenotype resulting from CRISPR4-pax2a
No data available

Phenotype of all Fish created by or utilizing CRISPR4-pax2a
No data available
OTHER CRISPR4-pax2a CRISPR PAGESNo links to external sites
CITATIONS (1)