CRISPR
CRISPR1-ncln
- ID
- ZDB-CRISPR-170419-2
- Name
- CRISPR1-ncln
- Previous Names
-
- CRISPR1-ncl1
- Target
- Sequence
-
5' - GGTAGGGTGGACATGTTGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-ncln
No data available
Phenotype
Phenotype resulting from CRISPR1-ncln
| Phenotype | Fish | Figures |
|---|---|---|
| intestine distal region lacks all parts of type enteric neuron, abnormal | em2Tg + CRISPR1-ncln |
Fig. 1 |
Phenotype of all Fish created by or utilizing CRISPR1-ncln
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| intestine distal region lacks all parts of type enteric neuron, abnormal | em2Tg + CRISPR1-ncln | standard conditions |
Fig. 1 |
Citations