CRISPR
CRISPR1-smchd1
- ID
- ZDB-CRISPR-170322-1
- Name
- CRISPR1-smchd1
- Previous Names
- None
- Target
- Sequence
-
5' - GAGATGTCGAAAGTCCGCGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was TGG at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-smchd1
No data available
Phenotype
Phenotype resulting from CRISPR1-smchd1
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing CRISPR1-smchd1
1 - 5 of 7 Show all
Citations
- Mooney, M.R., Davis, E.E., Katsanis, N. (2019) Analysis of Single Nucleotide Variants in CRISPR-Cas9 Edited Zebrafish Exomes Shows No Evidence of Off-Target Inflation. Frontiers in genetics. 10:949
- Shaw, N.D., Brand, H., Kupchinsky, Z.A., Bengani, H., Plummer, L., Jones, T.I., Erdin, S., Williamson, K.A., Rainger, J., Stortchevoi, A., Samocha, K., Currall, B.B., Dunican, D.S., Collins, R.L., Willer, J.R., Lek, A., Lek, M., Nassan, M., Pereira, S., Kammin, T., Lucente, D., Silva, A., Seabra, C.M., Chiang, C., An, Y., Ansari, M., Rainger, J.K., Joss, S., Smith, J.C., Lippincott, M.F., Singh, S.S., Patel, N., Jing, J.W., Law, J.R., Ferraro, N., Verloes, A., Rauch, A., Steindl, K., Zweier, M., Scheer, I., Sato, D., Okamoto, N., Jacobsen, C., Tryggestad, J., Chernausek, S., Schimmenti, L.A., Brasseur, B., Cesaretti, C., García-Ortiz, J.E., Buitrago, T.P., Silva, O.P., Hoffman, J.D., Mühlbauer, W., Ruprecht, K.W., Loeys, B.L., Shino, M., Kaindl, A.M., Cho, C.H., Morton, C.C., Meehan, R.R., van Heyningen, V., Liao, E.C., Balasubramanian, R., Hall, J.E., Seminara, S.B., Macarthur, D., Moore, S.A., Yoshiura, K.I., Gusella, J.F., Marsh, J.A., Graham, J.M., Lin, A.E., Katsanis, N., Jones, P.L., Crowley, W.F., Davis, E.E., FitzPatrick, D.R., Talkowski, M.E. (2017) SMCHD1 mutations associated with a rare muscular dystrophy can also cause isolated arhinia and Bosma arhinia microphthalmia syndrome. Nature Genetics. 49(2):238-248
1 - 2 of 2
Show