CRISPR

CRISPR1-rps14

ID
ZDB-CRISPR-160728-1
Name
CRISPR1-rps14
Previous Names
None
Target
Sequence
5' - CTTCTCGTCCAGTAGTCGGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf624 rps14
zf625 rps14
zf626 rps14
Expression
Gene expression in Wild Types + CRISPR1-rps14
No data available
Phenotype
Phenotype resulting from CRISPR1-rps14
Phenotype Fish Figures
erythroid lineage cell decreased amount, abnormal AB + CRISPR1-rps14 Fig. 1 from Ear et al., 2016
Phenotype of all Fish created by or utilizing CRISPR1-rps14
Phenotype Fish Conditions Figures
blood hemoglobin decreased amount, ameliorated rps14zf624/zf624 chemical treatment by environment: MMP9 inhibitor I Fig. 1 from Youn et al., 2019
eye decreased size, abnormal rps14zf624/zf624 chemical treatment by environment: MMP-9-IN-1 text only from Youn et al., 2019
pericardium edematous, abnormal rps14zf624/zf624 chemical treatment by environment: MMP-9-IN-1 text only from Youn et al., 2019
blood hemoglobin decreased amount, ameliorated rps14zf624/zf624 chemical treatment by environment: MMP-9-IN-1 Fig. 1 from Youn et al., 2019
blood hemoglobin decreased amount, abnormal rps14zf624/zf624 standard conditions Fig. 1,  Fig. 4 from Youn et al., 2019
whole organism mmp9 expression increased amount, abnormal rps14zf624/zf624 standard conditions Fig. 2 from Youn et al., 2019
brain necrotic, abnormal rps14zf624/zf624 chemical treatment by environment: MMP-9-IN-1 text only from Youn et al., 2019
blood hemoglobin decreased amount, ameliorated rps14zf624/zf624 chemical treatment by environment: SB 431542 Fig. 4 from Youn et al., 2019
head decreased size, abnormal rps14zf624/zf624 (AB) standard conditions Fig. S2 from Ear et al., 2016
erythroid lineage cell decreased amount, abnormal rps14zf624/zf624 (AB) standard conditions Fig. S2 from Ear et al., 2016
anatomical structure right side lft1 expression mislocalised, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 7 from Ear et al., 2016
whole organism cdkn1a expression increased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 6 from Ear et al., 2016
anatomical structure central side lft1 expression mislocalised, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 7 from Ear et al., 2016
whole organism rps14 expression decreased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 3 from Ear et al., 2016
heart edematous, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2 from Ear et al., 2016
whole organism decreased life span, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2 from Ear et al., 2016
apoptotic process increased occurrence, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2 from Ear et al., 2016
erythrocyte maturation decreased occurrence, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 4 from Ear et al., 2016
extension morphology, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2 from Ear et al., 2016
head aplastic, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2 from Ear et al., 2016
erythroid lineage cell hbae3 expression decreased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 5 from Ear et al., 2016
head decreased size, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2,  Fig. 3,  Fig. 6 from Ear et al., 2016
pigmentation delayed, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2 from Ear et al., 2016
erythroid lineage cell amount, ameliorated rps14zf626/zf626 (AB) chemical treatment: L-leucine Fig. 7 from Ear et al., 2016
whole organism lft1 expression increased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 7 from Ear et al., 2016
erythroid lineage cell hbbe1.1 expression decreased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 5 from Ear et al., 2016
erythroid lineage cell decreased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 4,  Fig. 6,  Fig. 7 from Ear et al., 2016
erythroid lineage cell amount, ameliorated rps14zf626/zf626 (AB) chemical treatment: dexamethasone Fig. 7 from Ear et al., 2016
whole organism tp53 expression increased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 6 from Ear et al., 2016
yolk edematous, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 2 from Ear et al., 2016
whole organism mdm2 expression increased amount, abnormal rps14zf626/zf626 (AB) standard conditions Fig. 6 from Ear et al., 2016
erythroid lineage cell decreased amount, abnormal AB + CRISPR1-rps14 standard conditions Fig. 1 from Ear et al., 2016
erythrocyte maturation decreased occurrence, abnormal rps14zf626/zf626; cz3325Tg standard conditions Fig. 4 from Ear et al., 2016
erythroid lineage cell decreased amount, abnormal rps14zf626/zf626; cz3325Tg standard conditions Fig. 4 from Ear et al., 2016
erythroid lineage cell amount, ameliorated rps14zf626/zf626 + MO4-tp53 standard conditions Fig. 6 from Ear et al., 2016
head size, ameliorated rps14zf626/zf626 + MO4-tp53 standard conditions Fig. 6 from Ear et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.