Community Action Needed: Please respond to the NIH RFI
CRISPR

CRISPR2-cbx8b

ID
ZDB-CRISPR-160525-25
Name
CRISPR2-cbx8b
Previous Names
None
Target
Sequence
5' - GAGTTTTGGCCCTCGTTTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-cbx8b
No data available
Phenotype
Phenotype resulting from CRISPR2-cbx8b
No data available
Phenotype of all Fish created by or utilizing CRISPR2-cbx8b
No data available
Citations