header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-160128-186
CRISPR Name: CRISPR1-trpv1
Target: trpv1 (2)
Previous Name: Z000247 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGTGACGTGTCTAAAATGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-trpv1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-trpv1No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-trpv1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-trpv1
No data available

Phenotype of all Fish created by or utilizing CRISPR1-trpv1
No data available
OTHER CRISPR1-trpv1 CRISPR PAGES
  • CRISPRz:Z000247 (1)
  • CITATIONS (2)