CRISPR
CRISPR1-mitfa
- ID
- ZDB-CRISPR-131118-4
- Name
- CRISPR1-mitfa
- Previous Names
-
- Z001408 (1)
- Target
- Sequence
-
5' - GGGGTCATGCCGTGCTCGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-mitfa
No data available
Phenotype
Phenotype resulting from CRISPR1-mitfa
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mitfa
No data available
Citations
- Bian, W.P., Xie, S.L., Wang, C., Martinovich, G.G., Ma, Y.B., Jia, P.P., Pei, D.S. (2023) mitfa deficiency promotes immune vigor and potentiates antitumor effects in zebrafish. Fish & shellfish immunology. 142:109130
- Chang, J., Chen, X., Zhang, T., Wang, R., Wang, A., Lan, X., Zhou, Y., Ma, S., Xia, Q. (2020) The novel insight into the outcomes of CRISPR/Cas9 editing intra- and inter-species. International journal of biological macromolecules. 163:711-717
- Burger, A., Lindsay, H., Felker, A., Hess, C., Anders, C., Chiavacci, E., Zaugg, J., Weber, L.M., Catena, R., Jinek, M., Robinson, M.D., Mosimann, C. (2016) Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development (Cambridge, England). 143(11):2025-37
- Jao, L.E., Wente, S.R., and Chen, W. (2013) Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110(34):13904-13909
1 - 4 of 4
Show