cDNA

MGC:110821

ID
ZDB-CDNA-050227-8
Name
MGC:110821
Symbol
MGC:110821
Previous Names
  • FR_9610 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
GISZF001_ra
Digest
Insert Size
1010
Cloning Site
Sfi A - Sfi B
Vector Type
plasmid
Vector
pDNR-LIB
Polymerase
T3 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGGATAACCGTATTACCGCC 3'
5' CGCGCAATTAACCCTCACTAAAGCACTAGTCATACCAGGATC 3'
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
1 figure (1 image) from Thisse et al., 2004 [MGC:110821]
Marker Relationships
Sequences
Citations