header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CDNA-040912-167
cDNA Name: MGC:92097
Sequence Ontology ID : SO:0000756
Previous Name: FR_7224 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NIH_ZGC_10
Digest:
Insert Size: 1753
Cloning Site: NotI-SmaI
Vector Type: Plasmid
Vector: pExpress-1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TAATACGACTCACTATAGGG 3'
5' GGATCCATTAACCCTCACTAAAGGGAAGTTTCGCTCCGGAATTCCCGGG 3'
Source:
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2004 [MGC:92097]
MARKER RELATIONSHIPS
MGC:92097 Is Encoded by: [Gene] irf9 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC081591 (1) 1753 bp
Genome Resources:
CITATIONS (3)