ZFIN ID: ZDB-ALT-980203-1111
Genomic Feature: tb8
Synonyms: B08A (1)
Affected Genomic Regions: cdh2
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 20: 17798887 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Ile>Asn at position 242 (1)
FLANKING SEQUENCE (GENOMIC)
AAATATTAAAACCGCACATGCAACCATACATTGTACAGATGGTAATGTTCCAATGACAACATTTTAAATGCATTTAATGGATGTCTAATAAACATCTAAACAAAGACAGCTAGGCTAAAACCAGGCAAACTTTGGGCTGTCAGTGAAAATCTAATTAAATATGCAGGAATGATTGACAACACTTGTGGTCTAATATCTGTATATTCGATGACCAGTCTATATTCGGGCTATTTTTAGTTATCTATTAGATTTTCACTGACAGACTCAAATTTATCCTTGTTTAAGCCAAGCAGTCTATACTGTACATGTCTGTTAAACACCAAATTGCTTAGTCTGTTGTGTCATATGCACAATGTACGCAGAGTATTGTTCATCCAGGTTTGAGTTTATAAAGAGTTTTTACATAAAACTAACTATACAAGTGTGTTTGCATTCACAGCTGCGTGCTCATGCAGTGGACATCAATGGAAACCAGATGGAGAATCCCATCGACATCATCA
T/A
CAATGTCATCGATATGAATGACAACCGGCCAGAGTTCACACACCAGATCTGGAATGGGACCGTGGATGAGGGTGCCAAACCAGGTACACACTTACAGATTCATGTTTTCCACTGAGGCTTGTAACACATCTTCACCAGTGAAGGGAAAAAGTGACATTTATTGCTTGGCTCTAGGAACATTCGTAATGACAGTGACCTCCCAGGATAAGGATGACCCAAATACAGCCAACGGGATGCTGCGATACAAAATCCTCTCTCAGACCCCAGAGAGCCCCTCATCCAACATGTTCACTATCAACAACAAAACCGGCAAAATCATCACAGTAGCTGCAGGCCTGGACCGTGAGGTAATGTCAACAGTATGCAACTATATTGTAGACCAGAGATTTTCATTAGTGTTATTTTTGGATTTGTATTGTCTGTTTTTATTTTAATTATACAGTTGAATCAGAATTATTAGCCCCCTTTTAGTTTTAATAGTTTTTCTAATAGTTTTTCTT
(1)
OTHER tb8 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cdh2tb8/tb8 cdh2 ♀+/- ♂+/-
Heterozygous cdh2tb8/+ cdh2 ♀+/- ♂+/-
cdh2tb8/+ cdh2 Unknown
Complex cdh2tb8/+; cdh2tm101/+ cdh2
cdh2tb8/tb8; gpc4m119/m119 cdh2, gpc4
cdh2tb8/tb8; vangl2m209/m209 cdh2, vangl2
cdh2tb8/tb8; tbx16b104/b104 cdh2, tbx16

CITATIONS  (9)