Genomic Feature
mz82
- ID
- ZDB-ALT-241104-47
- Name
- mz82
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one deletion (1)
- Protocol
- embryos treated with
- Lab of Origin
- Ketting Lab
- Current Source
- Other Pages
-
Notes
| Comment | Citation |
|---|---|
| PCR with for TCAGAGTTCGTGATTCCCAGC and rev ACACGAGTAGCAGTGCGATG | Zebrafish Nomenclature Committee |
| deletion of approx. 400bp | Zebrafish Nomenclature Committee |
Variants
- Variant Type
- Small Deletion
- Variant Location
- Unmapped
- Nucleotide change
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- None
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None