ZFIN ID: ZDB-ALT-190501-201
Genomic Feature: sa42327
Synonyms:
Affected Genomic Regions: trpc7b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 1756338 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
FLANKING SEQUENCE (GENOMIC)
CAGATTGGTCAGATGGGCCAATACTCTGCTCTGATTGGTCAGGTGGCCCTACAATCTGCTCAGATTGGTCAGATGGGCCAATATTCTGCTCTGATTGGTCAGATGGCCCTACAATCTGCTCAGATTGGTCAGATGGGCTAATACTCTGCTCTGATTGGTCAGATGGCCAAAAAAAATCTGCTCTGATTGGTCAGATGGCCCAATAATCTGCGCTATTTGGCCAGGTGGGCCAGTAATCTTCTCTGATTGGTCAGATGGACTAATAATCTGCTCTGATTGGTCAGATTGCCTAGACTGCTATGATTGGTTAACTAGGTATACTACTTATTTCCCTCAAAATACTGTACATGCCACTTTTTTCAAATATGGTCTAGTAAATTTGTGTTTACAGTACAGTAATGCGTGCATGAAAGATTTGAAGTCCCTGTTTATTTATTAGATTTAATAGCTAACATGTGAACACGTATCAGATGAGCGCTGTGTGTGTGCGTCTGCATTTC
(1)
OTHER sa42327 PAGES
ZMP:sa42327 (1)
GENOTYPES No data available

CITATIONS  (1)