Genomic Feature

y609

ID
ZDB-ALT-190403-8
Name
y609
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with CRISPR
Lab of Origin
Harold Burgess Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 6: 10286465 - 10286466 (GRCz11) (1) Details
Nucleotide change
CG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp deleted (1)
Transcript Consequence
None
Protein Consequence
Amino Acid Substitution: Ser>Stop at position 469 (1)
Sequences
Flanking Sequence
CATATTTATGTCAAATTAAATTCCCACTTGGACATTTTTAATGCATTTGTAGCACTTTTAGGCCACATTTGAGCCCTTTAATCCCCATAAGTGCATTACTGAGCATTTAATGCGAAGATTAAACCCTTTTCTGTCTCCTGTCACACCTTTGCTCAGTGCCATAGTTGATTATCACTCCACCCACATAAACTATGTAACAGAATATAGCTAAGAAGCTAACAAAACACAGAAGAGTTGACTAAACTACATTTCCCACAATGCCACACAGCAGAGCAAGTCACCTGATTAGGAGTTGAGCATTTCTTTTCATATGAGAGTCGGTTGGCATCAATGGAAAAGCGAAAGCCGGGCCGTCTGATGCTGTCCTCTGAGGCAGACTTGTGGAATTTCTCCTGGTCGGCTTTCTCCTCTTCCTCTCTCTGTTTTCTCTTCTTCCTGCGGTTCCTCCTTTCTTTAGCACTCTTCGAACTCAGTCTAGACCCCCCAGAGGAGCTCTCCTC
CG/- ACAGGCCCCCCCTTCCGCTGTACTCCCCGCTCTCTGTCGCTGCTGCCGCGGCAACCTGCCAACCAATCACAGCACAGGCACTGTCGTCAGGGGCAACCGTGGCTAGACTTAGTTCAAGCTTACATAGGGAAAGCAGAGGCAGGACATGGACAAACAGTGAGCGCCGAAGAACGACAGAAGATCACTTTATTTGTTTGGTCAGACTATCAGATTTTTGATTTTCTCACTAATCCATCTTTTCCTTATTAGGTCTCCCTTACTTGTAATATCCCATCTAATAACCCTAACTACCCCAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGAATGAGGGAGAGAGCGAGGGATAGATAGATAGATAGATAGATAGACAGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations