Genomic Feature

y608

ID
ZDB-ALT-190403-7
Name
y608
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
Lab of Origin
Harold Burgess Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 38114292 - 38114296 (GRCz11) (1) Details
Nucleotide change
CCCTG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Amino Acid Substitution: 91 AA added at position 344 (1)
Sequences
Flanking Sequence
AGGTTTTATTACACTTTATGTATTAGTCTCCAAGAGAGAAAACATTAGCATTATTTCAGATGTTAAAAACACCCGAGAAAGTTCACAGAACTATAAAAGAGATTTGAAAAAATGTTCTACCTGTGGCTGCAGCAGTAGTTTAAGGGGCACTGCTAGTCTTTGTCCTCCTTGGCCTTGAGAAATCTGCACCACCTGTGGACTGCCACCAGCATTTGCTGCCCCAGAAACCAACTGAAACTGTTGCAAGAAAAGCTTCAAGTCACCAGCGAGATACAAGTAAAAGCCAATCTTCCAACACCCAACCCTGTCCTTTCGCTCACCTTGGCTCCCTGTTGGTTGGGCTGCTGTTGAACCTGCAGCTGAATAGTGAGCACTTTTGCCTGTGCACCCGTTTGACCTGCCTTGGCTTGGGCGAGTGCTGCCAGCTGGTCTCCCTGCAGGACTAACTTCCCTGGCAGAGAGCCCAACACCAGCCTGGGCTGCTGGCCTTGCTGACCCGA
CCCTG/- CAGTTCCCCCTACTGTCACCGTCCCAGCTTGGGCAGCTCCACCTTGTGAGGGCTGCTGTAGCACCAGAGTGATCCTCTTTGCTTCCCCCTGAAAAAGAAAGAGGGGCTTTTAGGTCTCTGACAGCGGGGGAAAAAACTAAATAGAGCAATGCGAACAGTGTTCATTTACCATTGAAACACTTTAACAGTTTATCAATATTTGACATTAGGTGTTATTCTTAAGTGTTCTGTTTATATATTCTGTTGTGCTTTTATTTTTTGTTAATATAAAATGTCTATGTAGCTTTTCATGCACCTTTATTTTTGCACTTTACTTTAGATTGAATACTTAGATTGAATAGTTAAAGCAAAAATGTAAGTGTCAGATATCAGATGTCAAATATCAGATTTTCCCTATAATTTATTAAAGTGGTTTTAAAAGTTGTTTACATCATTTATTAGAGTGGTTTATTCAGGTTTTAGTCTGTATGATGATAATTCAAGTTAAAATCTGACCTGCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations