Genomic Feature

y607

ID
ZDB-ALT-190403-3
Name
y607
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with CRISPR
Lab of Origin
Harold Burgess Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 20: 5039683 - 5039695 (GRCz11) (1) Details
Nucleotide change
TTCCTCCGATGCC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
13 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Amino Acid Substitution: 16 AA added at position 391 (1)
Sequences
Flanking Sequence
TGAGCACAATTTAGAGCACACACACTTCTCAAACAATCCGGGAAATGGGCCTGGGCATGGTTCGGATAGCATAGTGTGAGTAGGCTCTAAAAGCCTTGTCTATTTCACGAGGTGCATGCACAGTCAGCAGAGTTTAGCGACGTGGCGGAAAGTATAAATCAGCCTTTAATCTCTTAAAATCAATAAAGCGCTTTATTTCATTTGTATCTTTGCTCTAATGTGTTTATCTATGCAAGTAATTTGTTTATTATTACTAATGCAGATACACTCCCCTACAAAATCATCCCAATCATTGTAAAATTATGAATTGTTTCCAAAAAGAGCTCAAAATCAACTGGCGAATCTGTATTTTTAATTGCAATATATAATCTCAGAGCACCAAAACATTGCAAAACCTCAAAGTATCATGCAGCCCTACTGTACAGCTTTAAAAAGAGCTTTGTTTTCTGAGTAATCTTTAGTAACACTCATTGTTTCTACCTGTTGCTGAGAGTACTGCA
TTCCTCCGATGCC/- AACTTGCCCACGGCCCTGCATTCCCATTGGATATCGGTGAGCAGTGGGTGATCCGTATGGCTGTCCGGCATAAGTTCCTTGCTGGGAATAGGGATTGTTGCCCATCCCATACATCTGAGAACGCTTCATGGTCATAGGGTCCATAGTTGCCACCTGTTGAGAGTGATGTCAACACTTTAGCATGAGGAACATCGACGGTGATTTCCAATGTAAGGCAGTCTGTGTGAACACATTTATGTGACTATTATGGCTGAGCAGACTGGAATACAAATAGTAATCATAAGGTTGAGCGCCTCGGTAAATGGAGAGATTCAGGGCAATGTGCCATCGACTGATATTGGGGGGTGAGTGGGGGGTGGGTTCAGGTTTTCTCTCAAGTGTCTCATCTTTGCCAGAAAAGACTGAGAGCCATCCAAGCTAATCTTCTCATGTCACTGCCAAATTCAGGCCAATTGAAGCAGCACTTACAGAAAATGTGACCAATTTGAGAAAGCCTGGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations