header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-325
Genomic Feature: sa44679
Synonyms:
Affected Genomic Regions: ptger4a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 903057 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
GCGACTCTCGCGGCCAGCAAACCCAAAACAGCCTGCTGTGTATAAACGGC
C/T
AGCAGTTTTCCTCCAGAGACTCTCCGTCTGCTGTGTCCCGCGAGCTCCAG
(1)
OTHER sa44679 PAGES
ZMP:sa44679 (1)
GENOTYPESNo data available

CITATIONS  (1)