Genomic Feature

fb103

ID
ZDB-ALT-160323-3
Name
fb103
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Langenau Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 7: 41355285 - 41355292 (GRCz11) (1) Details
Nucleotide change
CTTGGCAT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Asp>Stop at position 3612 (1)
Sequences
Flanking Sequence
TTTGCTTTATTTCGGCTAGAATAAAAGCAGTTTTTAGTAAAAAAAAAAAAAACATTTTAAGGACAAAATTATTTGCCCATTTAAGCTATATTATTTTTCGATAGTCTACAGAACAAACCATCGTTATACAATAACTTGCCTAATTACCCTAACCTGCCTAGTTAACCCAGTTAAGCCTAATAGGCTAATAATTCAGAGGGCAAAAAATTCTGCCTTCAACTATATATCATATATATACATACATGCATATATATATATATATATATAGAGAGAGAGAGAGAATATTTGTTATGTGATGACAGAGAGAGAAAGATATTTTATAGTTAAGACTTTTTATAAAGGAGTATTAAGTTTAAGATTATTTATTAATATTTGTATGCATATATGTAAACACACATAGCATATCAGAATTTTGGGCTTAATTTTATTAAACAAATCACAGTTATATGCAAGTTGTAAACCTGGATGAACTTTCTTCTGTAAGACCCAAATCTTGGAGA
CTTGGCAT/- CTCCAAGCAATTCAGTCATGTATTGTAGCTTCATTTTCTTTTTGTCCAGGTTTGGTTTGTCCAGTTGATTCTTCACCTCATCCCACCAGTCCTGTCAAACCATTAATTGAGAATCAATTCTTTGTAATGTCTTTGTAAGTTAAAATGCCCTAAGCAGCACCAACTAAAATCTGTCAGATCTGTTAAAACAGCTCCAGTTGGTACTTGAATTTTGGACAAAACTCACAGAGAAAAATGGTCCTATACCTTGAAAAGCATTTCAGGGTTTGAAAGTTGCTGAAGGGCATCTACAAACCCTTGGATGACACCACCTTTATCCAATAATGACTCCAGCCTGGAACATAAACAATAGTTTGCATGTCTCAATACGAGAAAAGCCAAAGCCACATCCAGAACTACAGAGATAAGTACACACTTCTCAACAAACTCTCGGTTCCTCTGACCACTTGCAGACTCCTCAAAAGTGTAGTTCTCACTGCTGATCATGTACGGGTATATGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations